Transcript: Human NM_138702.1

Homo sapiens MAGE family member C3 (MAGEC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
MAGEC3 (139081)
Length:
1932
CDS:
1..1932

Additional Resources:

NCBI RefSeq record:
NM_138702.1
NBCI Gene record:
MAGEC3 (139081)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083123 CCCGACCATTTCTATGTCTTT pLKO.1 736 CDS 100% 4.950 6.930 N MAGEC3 n/a
2 TRCN0000083125 CATGAGTTCATAGAGCTAATT pLKO.1 1504 CDS 100% 13.200 9.240 N MAGEC3 n/a
3 TRCN0000413674 TCTCAGTATGATCTTCATAAA pLKO_005 1656 CDS 100% 13.200 9.240 N MAGEC3 n/a
4 TRCN0000083126 CCATGAGTTCATAGAGCTAAT pLKO.1 1503 CDS 100% 10.800 7.560 N MAGEC3 n/a
5 TRCN0000442830 CCTATGAGGGAAGCCTGATTG pLKO_005 1595 CDS 100% 10.800 7.560 N MAGEC3 n/a
6 TRCN0000083127 CGACAACCACTCCTATTTCTT pLKO.1 1554 CDS 100% 5.625 3.938 N MAGEC3 n/a
7 TRCN0000083124 GCAAGAGAAGTCTTAGAGTTT pLKO.1 1744 CDS 100% 4.950 3.465 N MAGEC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04924 pDONR223 100% 38.5% 33.3% None (many diffs) n/a
2 ccsbBroad304_04924 pLX_304 0% 38.5% 33.3% V5 (many diffs) n/a
3 TRCN0000474881 AGGTGCAAGCATGGCAACCTTTTT pLX_317 27.5% 38.5% 33.3% V5 (many diffs) n/a
Download CSV