Transcript: Mouse NM_138751.2

Mus musculus transmembrane protein 47 (Tmem47), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmem47 (192216)
Length:
4082
CDS:
292..837

Additional Resources:

NCBI RefSeq record:
NM_138751.2
NBCI Gene record:
Tmem47 (192216)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330862 CATTCCTGGTGGGTTTGATTT pLKO_005 575 CDS 100% 13.200 9.240 N TMEM47 n/a
2 TRCN0000154183 CAGATTGCTACTCTGGCTTTA pLKO.1 523 CDS 100% 10.800 7.560 N TMEM47 n/a
3 TRCN0000330933 CAGATTGCTACTCTGGCTTTA pLKO_005 523 CDS 100% 10.800 7.560 N TMEM47 n/a
4 TRCN0000126229 GCTGATTAGATATAGGCATAT pLKO.1 1130 3UTR 100% 10.800 7.560 N Tmem47 n/a
5 TRCN0000126230 GCATTCCTGGTGGGTTTGATT pLKO.1 574 CDS 100% 5.625 3.938 N Tmem47 n/a
6 TRCN0000157498 GCATTCCTGGTGGGTTTGATT pLKO.1 574 CDS 100% 5.625 3.938 N TMEM47 n/a
7 TRCN0000351840 GCATTCCTGGTGGGTTTGATT pLKO_005 574 CDS 100% 5.625 3.938 N Tmem47 n/a
8 TRCN0000126233 CAGCCTGGTTCTTTATCCAAT pLKO.1 675 CDS 100% 4.950 3.465 N Tmem47 n/a
9 TRCN0000351841 CAGCCTGGTTCTTTATCCAAT pLKO_005 675 CDS 100% 4.950 3.465 N Tmem47 n/a
10 TRCN0000157875 CATTGCATTCCTGGTGGGTTT pLKO.1 570 CDS 100% 4.050 2.835 N TMEM47 n/a
11 TRCN0000126231 GCAGATTGCTACTCTGGCTTT pLKO.1 522 CDS 100% 4.050 2.835 N Tmem47 n/a
12 TRCN0000367651 GCAGATTGCTACTCTGGCTTT pLKO_005 522 CDS 100% 4.050 2.835 N Tmem47 n/a
13 TRCN0000126232 TGCCATTCTTTATTGCCTGAA pLKO.1 789 CDS 100% 4.050 2.835 N Tmem47 n/a
14 TRCN0000351842 TGCCATTCTTTATTGCCTGAA pLKO_005 789 CDS 100% 4.050 2.835 N Tmem47 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 916 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09102 pDONR223 100% 93% 98.8% None (many diffs) n/a
2 ccsbBroad304_09102 pLX_304 0% 93% 98.8% V5 (many diffs) n/a
3 TRCN0000465687 ATGGATTGAAGTGGTTCCCTTGCA pLX_317 64.2% 93% 98.8% V5 (many diffs) n/a
Download CSV