Transcript: Mouse NM_138758.1

Mus musculus trimethyllysine hydroxylase, epsilon (Tmlhe), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmlhe (192289)
Length:
2264
CDS:
129..1394

Additional Resources:

NCBI RefSeq record:
NM_138758.1
NBCI Gene record:
Tmlhe (192289)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138758.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248352 CGCTCAGCATCATGCTATAAT pLKO_005 369 CDS 100% 15.000 21.000 N Tmlhe n/a
2 TRCN0000248350 AGAATGAGCTTTGGGTCAAAT pLKO_005 1228 CDS 100% 13.200 18.480 N Tmlhe n/a
3 TRCN0000217441 GAATGAGCTTTGGGTCAAATT pLKO.1 1229 CDS 100% 13.200 18.480 N Tmlhe n/a
4 TRCN0000248354 ATCGAAAGTGCTAGGATTATG pLKO_005 1396 3UTR 100% 13.200 10.560 N Tmlhe n/a
5 TRCN0000248353 ACAAAGCAGGCTCCGTAATTT pLKO_005 155 CDS 100% 15.000 10.500 N Tmlhe n/a
6 TRCN0000248351 AGCCTGGAAAGGTACTATTTA pLKO_005 1252 CDS 100% 15.000 10.500 N Tmlhe n/a
7 TRCN0000200658 CCTGGAAAGGTACTATTTATA pLKO.1 1254 CDS 100% 15.000 10.500 N Tmlhe n/a
8 TRCN0000192558 GCCTGGAAAGGTACTATTTAT pLKO.1 1253 CDS 100% 15.000 10.500 N Tmlhe n/a
9 TRCN0000192768 CCCTAACAACTGAATTGAGAA pLKO.1 1201 CDS 100% 4.950 3.465 N Tmlhe n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138758.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03551 pDONR223 100% 75.2% 68.8% None (many diffs) n/a
2 ccsbBroad304_03551 pLX_304 0% 75.2% 68.8% V5 (many diffs) n/a
3 TRCN0000469125 GCATAAAGATCGCATCCGCGAGCT pLX_317 33.6% 75.2% 68.8% V5 (many diffs) n/a
Download CSV