Transcript: Human NM_138800.3

Homo sapiens tripartite motif containing 43 (TRIM43), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TRIM43 (129868)
Length:
1699
CDS:
154..1494

Additional Resources:

NCBI RefSeq record:
NM_138800.3
NBCI Gene record:
TRIM43 (129868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138800.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240232 ACCGCTTCCGAGTGGAAATTT pLKO_005 1001 CDS 100% 15.000 7.500 Y TRIM43B n/a
2 TRCN0000240228 GTTAACTCTGAGGACATATTT pLKO_005 1249 CDS 100% 15.000 7.500 Y TRIM43B n/a
3 TRCN0000418648 CCGCTTCCGAGTGGAAATTTC pLKO_005 1002 CDS 100% 13.200 6.600 Y TRIM43 n/a
4 TRCN0000240230 CTGTTTGGGAACTCCATATAC pLKO_005 1514 3UTR 100% 13.200 6.600 Y TRIM43B n/a
5 TRCN0000428926 GGTTAACTCTGAGGACATATT pLKO_005 1248 CDS 100% 13.200 6.600 Y TRIM43 n/a
6 TRCN0000240229 TCTGAAGGTGGATAATCATTT pLKO_005 1281 CDS 100% 13.200 6.600 Y TRIM43B n/a
7 TRCN0000034094 CGGTTCTCCATAAGGAAGAAA pLKO.1 716 CDS 100% 5.625 2.813 Y TRIM43 n/a
8 TRCN0000034096 GAAGGTGGATAATCATTTCAA pLKO.1 1284 CDS 100% 5.625 2.813 Y TRIM43 n/a
9 TRCN0000034097 TGGGACCCATAGGCAAACAAA pLKO.1 432 CDS 100% 5.625 2.813 Y TRIM43 n/a
10 TRCN0000034098 CTTCTCCTTTGGGAAACACTA pLKO.1 1146 CDS 100% 4.950 2.475 Y TRIM43 n/a
11 TRCN0000034095 CAATCACAATATCAGGCTCTT pLKO.1 1041 CDS 100% 4.050 2.025 Y TRIM43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138800.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04857 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04857 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465853 ACGCTTACCGCACCAGTAAGAATT pLX_317 27% 100% 100% V5 n/a
Download CSV