Transcript: Human NM_138817.3

Homo sapiens solute carrier family 7 member 13 (SLC7A13), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SLC7A13 (157724)
Length:
1867
CDS:
105..1517

Additional Resources:

NCBI RefSeq record:
NM_138817.3
NBCI Gene record:
SLC7A13 (157724)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138817.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043163 CCATTGGTAAAGTCTCCAAAT pLKO.1 1341 CDS 100% 10.800 15.120 N SLC7A13 n/a
2 TRCN0000043166 GTGTCCATACTTAGCTTCATT pLKO.1 606 CDS 100% 5.625 7.875 N SLC7A13 n/a
3 TRCN0000436128 AGTTCTCAGCGGATTACTATT pLKO_005 1388 CDS 100% 13.200 9.240 N SLC7A13 n/a
4 TRCN0000423241 CCCTCATTAGCATGGATTATG pLKO_005 957 CDS 100% 13.200 9.240 N SLC7A13 n/a
5 TRCN0000043167 CCCTGATGTGTCTGAGGAATA pLKO.1 1496 CDS 100% 10.800 7.560 N SLC7A13 n/a
6 TRCN0000043165 CACGGGTTCATTATGGTCTAT pLKO.1 1199 CDS 100% 4.950 3.465 N SLC7A13 n/a
7 TRCN0000043164 GCCTAAGAAATGTCTGGCATT pLKO.1 500 CDS 100% 4.050 2.835 N SLC7A13 n/a
8 TRCN0000420322 AGATTCCAAATCAAGGTTAAA pLKO_005 1569 3UTR 100% 13.200 7.920 N SLC7A13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138817.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09715 pDONR223 100% 99.9% 99.7% None 745G>A n/a
2 ccsbBroad304_09715 pLX_304 0% 99.9% 99.7% V5 745G>A n/a
3 TRCN0000469249 TAAAAATGACTCATACCGGTTAGG pLX_317 32% 99.9% 99.7% V5 745G>A n/a
Download CSV