Transcript: Human NM_139075.4

Homo sapiens two pore segment channel 2 (TPCN2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TPCN2 (219931)
Length:
4969
CDS:
67..2325

Additional Resources:

NCBI RefSeq record:
NM_139075.4
NBCI Gene record:
TPCN2 (219931)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139075.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438900 CGAGTACCAGTCTCCGTTTCT pLKO_005 1311 CDS 100% 4.950 6.930 N TPCN2 n/a
2 TRCN0000043918 CGACGGTATTACTCGAACGTA pLKO.1 289 CDS 100% 3.000 4.200 N TPCN2 n/a
3 TRCN0000043920 CGATGTGATGATTCCTGCGTA pLKO.1 891 CDS 100% 2.640 2.112 N TPCN2 n/a
4 TRCN0000043921 CCCGTGGTCCAAGATCTATTT pLKO.1 2067 CDS 100% 13.200 9.240 N TPCN2 n/a
5 TRCN0000419624 AGGTGTTTCTGGATGCATATC pLKO_005 2033 CDS 100% 10.800 7.560 N TPCN2 n/a
6 TRCN0000043919 GCTTGACAGAAGTGTGGTTAA pLKO.1 1272 CDS 100% 10.800 7.560 N TPCN2 n/a
7 TRCN0000433692 GTCTTCATCGAAGATGCTATT pLKO_005 217 CDS 100% 10.800 7.560 N TPCN2 n/a
8 TRCN0000438083 TGCAGAACATGCGTGCGTTTG pLKO_005 1793 CDS 100% 6.000 4.200 N TPCN2 n/a
9 TRCN0000043922 GCTGAACATGCTCATCGTGTT pLKO.1 1704 CDS 100% 4.050 2.835 N TPCN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139075.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09851 pDONR223 100% 99.7% 99.7% None (many diffs) n/a
2 ccsbBroad304_09851 pLX_304 0% 99.7% 99.7% V5 (many diffs) n/a
3 TRCN0000480853 TTAGTAACGGGGGTCCGAAAAGAA pLX_317 18.7% 99.7% 99.7% V5 (many diffs) n/a
Download CSV