Transcript: Mouse NM_139143.3

Mus musculus solute carrier family 39 (metal ion transporter), member 6 (Slc39a6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc39a6 (106957)
Length:
3905
CDS:
541..2838

Additional Resources:

NCBI RefSeq record:
NM_139143.3
NBCI Gene record:
Slc39a6 (106957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139143.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079621 CCACTCATGAACCGGGTATTT pLKO.1 1609 CDS 100% 13.200 18.480 N Slc39a6 n/a
2 TRCN0000308541 CCACTCATGAACCGGGTATTT pLKO_005 1609 CDS 100% 13.200 18.480 N Slc39a6 n/a
3 TRCN0000079619 GCCATCATCAATCAAATTGAT pLKO.1 1444 CDS 100% 0.563 0.788 N Slc39a6 n/a
4 TRCN0000308531 GCCATCATCAATCAAATTGAT pLKO_005 1444 CDS 100% 0.563 0.788 N Slc39a6 n/a
5 TRCN0000079620 CCTGAGATGTTGCACAATGAT pLKO.1 2689 CDS 100% 5.625 3.938 N Slc39a6 n/a
6 TRCN0000308539 CCTGAGATGTTGCACAATGAT pLKO_005 2689 CDS 100% 5.625 3.938 N Slc39a6 n/a
7 TRCN0000079618 GCCTGAAGTTATGTGAACATT pLKO.1 3614 3UTR 100% 5.625 3.938 N Slc39a6 n/a
8 TRCN0000308455 GCCTGAAGTTATGTGAACATT pLKO_005 3614 3UTR 100% 5.625 3.938 N Slc39a6 n/a
9 TRCN0000079622 GCTCTGTTGAATGCAACGGAA pLKO.1 1405 CDS 100% 2.640 1.848 N Slc39a6 n/a
10 TRCN0000308540 GCTCTGTTGAATGCAACGGAA pLKO_005 1405 CDS 100% 2.640 1.848 N Slc39a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139143.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02854 pDONR223 100% 48.7% 53.4% None (many diffs) n/a
2 ccsbBroad304_02854 pLX_304 0% 48.7% 53.4% V5 (many diffs) n/a
3 TRCN0000471002 CCACCTAAGTCAATCTTTTAGAAT pLX_317 31.3% 48.7% 53.4% V5 (many diffs) n/a
Download CSV