Transcript: Mouse NM_139298.2

Mus musculus wingless-type MMTV integration site family, member 9A (Wnt9a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Wnt9a (216795)
Length:
3318
CDS:
44..1141

Additional Resources:

NCBI RefSeq record:
NM_139298.2
NBCI Gene record:
Wnt9a (216795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426431 TTCCGCTTTGAGCGCTGGAAC pLKO_005 332 CDS 100% 1.350 1.080 N WNT9A n/a
2 TRCN0000071965 AGGCTTCAAGGAGACTGCTTT pLKO.1 394 CDS 100% 4.950 3.465 N Wnt9a n/a
3 TRCN0000071964 CTTTCCTCTACGCCATCTCTT pLKO.1 411 CDS 100% 4.950 3.465 N Wnt9a n/a
4 TRCN0000071966 CAGCAGCAAGTTTGTCAAGGA pLKO.1 565 CDS 100% 2.640 1.848 N Wnt9a n/a
5 TRCN0000071967 GAAACCACTTGCAAATGCCAT pLKO.1 677 CDS 100% 2.640 1.848 N Wnt9a n/a
6 TRCN0000071963 GAGAAGAACTGTGAGAGTATT pLKO.1 989 CDS 100% 13.200 7.920 N Wnt9a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07136 pDONR223 100% 89.1% 98% None (many diffs) n/a
2 ccsbBroad304_07136 pLX_304 0% 89.1% 98% V5 (many diffs) n/a
3 TRCN0000481446 CGCACGCACCATTTCGTCACGGCG pLX_317 37.1% 89.1% 98% V5 (many diffs) n/a
Download CSV