Transcript: Human NM_139354.3

Homo sapiens megakaryocyte-associated tyrosine kinase (MATK), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
MATK (4145)
Length:
1875
CDS:
265..1665

Additional Resources:

NCBI RefSeq record:
NM_139354.3
NBCI Gene record:
MATK (4145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149242 ATTGGGAGCACAGATCGGAG pXPR_003 AGG 601 43% 7 0.686 MATK MATK 77014
2 BRDN0001146012 ACACGGCCTCATCGATTGTG pXPR_003 AGG 413 29% 5 0.4256 MATK MATK 77015
3 BRDN0001149205 TGAGACCAAAGCGGAAACAC pXPR_003 GGG 516 37% 6 0.1545 MATK MATK 77013
4 BRDN0001146191 CGCGTCAAGCACCACACCAG pXPR_003 TGG 155 11% 4 -0.2568 MATK MATK 77012
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139354.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237851 TGGTGAGACCAAAGCGGAAAC pLKO_005 761 CDS 100% 6.000 8.400 N MATK n/a
2 TRCN0000355857 CAATCGATGAGGCCGTGTTCT pLKO_005 677 CDS 100% 4.950 6.930 N MATK n/a
3 TRCN0000378189 TACGTCCTGTGCGTGAGCTTT pLKO_005 607 CDS 100% 4.950 6.930 N MATK n/a
4 TRCN0000002220 GACGAAGATGCAACACGAGAA pLKO.1 981 CDS 100% 4.050 5.670 N MATK n/a
5 TRCN0000199107 CAAGAGCTGGTACCGCGTCAA pLKO.1 390 CDS 100% 0.000 0.000 N MATK n/a
6 TRCN0000002221 CAAGTCGGATGTCTGGAGTTT pLKO.1 1350 CDS 100% 4.950 3.960 N MATK n/a
7 TRCN0000244304 AGGGCAACCTGGTGAACTTTC pLKO_005 1067 CDS 100% 10.800 7.560 N MATK n/a
8 TRCN0000237850 CATGGACATGGTGGAGCATTA pLKO_005 708 CDS 100% 10.800 7.560 N MATK n/a
9 TRCN0000237849 TTACTGAACCTGCAGCATTTG pLKO_005 826 CDS 100% 10.800 7.560 N MATK n/a
10 TRCN0000355858 GGCTCTCAAACACGGGAAGTT pLKO_005 1323 CDS 100% 4.950 3.465 N MATK n/a
11 TRCN0000002223 CTTCTGCAACCTCATGGACAT pLKO.1 696 CDS 100% 4.050 2.835 N MATK n/a
12 TRCN0000002219 GCATTTGACATTGGGAGCACA pLKO.1 840 CDS 100% 2.640 1.848 N MATK n/a
13 TRCN0000199564 GCCCGCAACATCCTGGTCTCA pLKO.1 1204 CDS 100% 0.000 0.000 N MATK n/a
14 TRCN0000237852 CACCCAGTGTATCACCAAATG pLKO_005 291 CDS 100% 10.800 6.480 N MATK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139354.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14694 pDONR223 0% 91.9% 91.9% None 0_1ins123 n/a
2 ccsbBroad304_14694 pLX_304 0% 91.9% 91.9% V5 0_1ins123 n/a
3 TRCN0000471647 TCGGTCCAATATTTAGTTCTGCTT pLX_317 28.4% 91.9% 91.9% V5 0_1ins123 n/a
4 TRCN0000489618 TACACCTGACTTTACCGGCATTTC pLX_317 27.9% 91.9% 91.9% V5 (not translated due to prior stop codon) 0_1ins123 n/a
5 TRCN0000489779 GCCGATCGCGCTTCGCGCGTGTAC pLX_317 26.7% 91.9% 91.9% V5 (not translated due to prior stop codon) 0_1ins123 n/a
6 TRCN0000488126 GATCCGACTCTAGGCGACTATCGT pLX_317 20% 91.8% 91.7% V5 0_1ins123;1398_1399insG n/a
Download CSV