Transcript: Mouse NM_144529.2

Mus musculus Rho GTPase activating protein 17 (Arhgap17), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Arhgap17 (70497)
Length:
3503
CDS:
110..2650

Additional Resources:

NCBI RefSeq record:
NM_144529.2
NBCI Gene record:
Arhgap17 (70497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319599 CAAGTTCTTCGTGACGTTATT pLKO_005 736 CDS 100% 13.200 18.480 N Arhgap17 n/a
2 TRCN0000047452 CCCAAGCAGATTACCATAGAA pLKO.1 762 CDS 100% 5.625 7.875 N ARHGAP17 n/a
3 TRCN0000286245 CCCAAGCAGATTACCATAGAA pLKO_005 762 CDS 100% 5.625 7.875 N ARHGAP17 n/a
4 TRCN0000112877 CCACCATTCACATAAGCGTTT pLKO.1 238 CDS 100% 4.050 5.670 N Arhgap17 n/a
5 TRCN0000317849 CCACCATTCACATAAGCGTTT pLKO_005 238 CDS 100% 4.050 5.670 N Arhgap17 n/a
6 TRCN0000112878 CCCAGACCAGTGACGTTAATA pLKO.1 1266 CDS 100% 15.000 10.500 N Arhgap17 n/a
7 TRCN0000317850 CCCAGACCAGTGACGTTAATA pLKO_005 1266 CDS 100% 15.000 10.500 N Arhgap17 n/a
8 TRCN0000112875 GCCAGAATATGGAGAGAAATA pLKO.1 3220 3UTR 100% 13.200 9.240 N Arhgap17 n/a
9 TRCN0000112879 CCAAGCAGAATCCATCGCAAA pLKO.1 2340 CDS 100% 4.050 2.835 N Arhgap17 n/a
10 TRCN0000319597 TACCGACAGCAGGAGTATTAC pLKO_005 2904 3UTR 100% 0.000 0.000 N Arhgap17 n/a
11 TRCN0000319598 CTGGACACTGTGCGTTCAATG pLKO_005 215 CDS 100% 10.800 6.480 N Arhgap17 n/a
12 TRCN0000112876 GCTCTTGAACTCTCACAACAT pLKO.1 422 CDS 100% 4.950 2.970 N Arhgap17 n/a
13 TRCN0000158276 CAGCAACAACAGCAGCAACAA pLKO.1 2144 CDS 100% 4.950 2.475 Y RBMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03526 pDONR223 100% 80.2% 84.3% None (many diffs) n/a
2 ccsbBroad304_03526 pLX_304 0% 80.2% 84.3% V5 (many diffs) n/a
3 TRCN0000474970 TTAAGGCAACATTGCCGTCATCAA pLX_317 18.5% 80.2% 84.3% V5 (many diffs) n/a
Download CSV