Transcript: Human NM_144570.3

Homo sapiens Jupiter microtubule associated homolog 2 (JPT2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
JPT2 (90861)
Length:
3695
CDS:
35..607

Additional Resources:

NCBI RefSeq record:
NM_144570.3
NBCI Gene record:
JPT2 (90861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144570.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072553 GCCTGTATTTGGAAGATTTAA pLKO.1 2778 3UTR 100% 15.000 10.500 N JPT2 n/a
2 TRCN0000174476 CTAATAGGATGGCATCTAATA pLKO.1 153 CDS 100% 13.200 9.240 N Hn1l n/a
3 TRCN0000298452 GAGGGAAGACCAGCGACATTT pLKO_005 297 CDS 100% 13.200 9.240 N JPT2 n/a
4 TRCN0000293215 TGGGAAGAGGGTTAGTCTTAT pLKO_005 697 3UTR 100% 13.200 9.240 N JPT2 n/a
5 TRCN0000298453 ACATACCCAAGAGGACAAATC pLKO_005 201 CDS 100% 10.800 7.560 N JPT2 n/a
6 TRCN0000293214 CCAGCATCTCCTTCTACTAAG pLKO_005 588 CDS 100% 10.800 7.560 N JPT2 n/a
7 TRCN0000072554 GCCTAATAGGATGGCATCTAA pLKO.1 151 CDS 100% 5.625 3.938 N JPT2 n/a
8 TRCN0000072556 GTGGTATCTTTGACGAATCAA pLKO.1 240 CDS 100% 5.625 3.938 N JPT2 n/a
9 TRCN0000286262 GTGGTATCTTTGACGAATCAA pLKO_005 240 CDS 100% 5.625 3.938 N JPT2 n/a
10 TRCN0000072557 CACCCAAACAAACCCAAGGAT pLKO.1 353 CDS 100% 3.000 2.100 N JPT2 n/a
11 TRCN0000072555 CGGATCTTAAAGCTGCAAGGA pLKO.1 408 CDS 100% 2.640 1.848 N JPT2 n/a
12 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 3422 3UTR 100% 4.050 2.025 Y ERN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144570.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04534 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04534 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481214 CCCCCAATCGTGCTCCTTCACCTG pLX_317 78.3% 100% 100% V5 n/a
Download CSV