Transcript: Mouse NM_144793.1

Mus musculus solute carrier family 25, member 38 (Slc25a38), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Slc25a38 (208638)
Length:
1594
CDS:
46..1026

Additional Resources:

NCBI RefSeq record:
NM_144793.1
NBCI Gene record:
Slc25a38 (208638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249710 GCGCCTTAGAATATTGGTAAT pLKO_005 1312 3UTR 100% 10.800 15.120 N Slc25a38 n/a
2 TRCN0000216276 CATGTTACACCCAGTGATTAA pLKO.1 171 CDS 100% 13.200 10.560 N Slc25a38 n/a
3 TRCN0000249712 CATGTTACACCCAGTGATTAA pLKO_005 171 CDS 100% 13.200 10.560 N Slc25a38 n/a
4 TRCN0000249708 CGCTATGAGAGTGGGACTTAC pLKO_005 553 CDS 100% 10.800 8.640 N Slc25a38 n/a
5 TRCN0000249709 ATTTCTCCTGTGGGATATTTG pLKO_005 770 CDS 100% 13.200 9.240 N Slc25a38 n/a
6 TRCN0000175107 GTATTCTTCGAAGCAGTATTT pLKO.1 429 CDS 100% 13.200 9.240 N Slc25a38 n/a
7 TRCN0000249711 TCTACTTTGGCACCCTGTATT pLKO_005 413 CDS 100% 13.200 9.240 N Slc25a38 n/a
8 TRCN0000173973 GAAAGGGATGTCTCCTTCCAT pLKO.1 366 CDS 100% 3.000 2.100 N Slc25a38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08438 pDONR223 100% 77.9% 80.9% None (many diffs) n/a
2 ccsbBroad304_08438 pLX_304 0% 77.9% 80.9% V5 (many diffs) n/a
3 TRCN0000479664 TGTGAATACTGTGATATTGAGTTA pLX_317 39.3% 77.9% 80.9% V5 (many diffs) n/a
Download CSV