Transcript: Mouse NM_144823.4

Mus musculus acyl-CoA synthetase long-chain family member 6 (Acsl6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Acsl6 (216739)
Length:
2592
CDS:
82..2250

Additional Resources:

NCBI RefSeq record:
NM_144823.4
NBCI Gene record:
Acsl6 (216739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144823.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076065 TGCACGGTAATCGTCGATAAA pLKO.1 742 CDS 100% 13.200 18.480 N Acsl6 n/a
2 TRCN0000076067 CTTACCCATTACTATGACGAT pLKO.1 400 CDS 100% 2.640 3.696 N Acsl6 n/a
3 TRCN0000076064 GAGCGGAATCATCAGAAACAA pLKO.1 1362 CDS 100% 5.625 3.938 N Acsl6 n/a
4 TRCN0000076063 GCCAGAGAAGATCGAGAACAT pLKO.1 1863 CDS 100% 4.950 3.465 N Acsl6 n/a
5 TRCN0000076066 GCAAAGGAGAAGGAGAGATAT pLKO.1 1661 CDS 100% 13.200 7.920 N Acsl6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144823.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11716 pDONR223 100% 76% 78.6% None (many diffs) n/a
2 ccsbBroad304_11716 pLX_304 0% 76% 78.6% V5 (many diffs) n/a
3 TRCN0000479244 CACACGAATACCCCGGTTTGGTAC pLX_317 6.5% 76% 78.6% V5 (many diffs) n/a
Download CSV