Transcript: Mouse NM_144858.2

Mus musculus dihydrouridine synthase 3-like (S. cerevisiae) (Dus3l), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dus3l (224907)
Length:
2321
CDS:
106..2019

Additional Resources:

NCBI RefSeq record:
NM_144858.2
NBCI Gene record:
Dus3l (224907)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144858.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375503 AGAGGCCACCCTATTACTTAG pLKO_005 1865 CDS 100% 10.800 15.120 N Dus3l n/a
2 TRCN0000173669 CCACGAATATCTGGATGGAGA pLKO.1 216 CDS 100% 2.640 3.696 N Dus3l n/a
3 TRCN0000366622 GACTTCACTCACTACGGTTTA pLKO_005 1720 CDS 100% 10.800 7.560 N Dus3l n/a
4 TRCN0000366693 GGCAATTGAATCCCGTGAAAG pLKO_005 342 CDS 100% 10.800 7.560 N Dus3l n/a
5 TRCN0000379308 AGGCACTCACCGTCCATCATA pLKO_005 2126 3UTR 100% 5.625 3.938 N Dus3l n/a
6 TRCN0000173147 CATGTGCATTTGGAGACCGTT pLKO.1 473 CDS 100% 2.640 1.848 N Dus3l n/a
7 TRCN0000173248 CCAAAGCAGAATAGCTGCCAT pLKO.1 832 CDS 100% 2.640 1.848 N Dus3l n/a
8 TRCN0000173707 CGGTTCCACGAATATCTGGAT pLKO.1 211 CDS 100% 2.640 1.848 N Dus3l n/a
9 TRCN0000173326 GAAAGCTGTATCTGGCTCCTT pLKO.1 980 CDS 100% 2.640 1.848 N Dus3l n/a
10 TRCN0000375479 CCGCCAAGTTCCAACAGATTG pLKO_005 1307 CDS 100% 10.800 6.480 N Dus3l n/a
11 TRCN0000366692 GGCTGTTCACGGAGATCAAAG pLKO_005 1649 CDS 100% 10.800 6.480 N Dus3l n/a
12 TRCN0000375478 TTTGAGACAAGATCTCCTGTT pLKO_005 2074 3UTR 100% 4.050 2.430 N Dus3l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144858.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15929 pDONR223 0% 53.1% 56% None (many diffs) n/a
2 ccsbBroad304_15929 pLX_304 0% 53.1% 56% V5 (many diffs) n/a
3 TRCN0000481079 GAACTCTTTGTCAGTCCGACACAG pLX_317 36.4% 53.1% 56% V5 (many diffs) n/a
Download CSV