Transcript: Mouse NM_144884.2

Mus musculus torsin family 1, member A (torsin A) (Tor1a), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Tor1a (30931)
Length:
1452
CDS:
65..1066

Additional Resources:

NCBI RefSeq record:
NM_144884.2
NBCI Gene record:
Tor1a (30931)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008485 CCGGAACCTCATAGATTATTT pLKO.1 844 CDS 100% 15.000 21.000 N Tor1a n/a
2 TRCN0000280523 CCGGAACCTCATAGATTATTT pLKO_005 844 CDS 100% 15.000 21.000 N Tor1a n/a
3 TRCN0000008486 CCTTTCCTAGACTATTACGAT pLKO.1 620 CDS 100% 3.000 4.200 N Tor1a n/a
4 TRCN0000280524 CCTTTCCTAGACTATTACGAT pLKO_005 620 CDS 100% 3.000 4.200 N Tor1a n/a
5 TRCN0000008483 CCAGCATTCTGGACTTGTGAT pLKO.1 1247 3UTR 100% 4.950 3.465 N Tor1a n/a
6 TRCN0000280516 CCAGCATTCTGGACTTGTGAT pLKO_005 1247 3UTR 100% 4.950 3.465 N Tor1a n/a
7 TRCN0000008484 GCCTCTAACATCACACAGTAT pLKO.1 488 CDS 100% 4.950 3.465 N Tor1a n/a
8 TRCN0000008487 GCTGCAGAAAGATCTGGATAA pLKO.1 247 CDS 100% 10.800 6.480 N Tor1a n/a
9 TRCN0000280525 GCTGCAGAAAGATCTGGATAA pLKO_005 247 CDS 100% 10.800 6.480 N Tor1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06133 pDONR223 100% 85.7% 90.3% None (many diffs) n/a
2 ccsbBroad304_06133 pLX_304 0% 85.7% 90.3% V5 (many diffs) n/a
3 TRCN0000469618 ACCTCCCCCTTAATATCGTTATAG pLX_317 38.4% 85.7% 90.3% V5 (many diffs) n/a
Download CSV