Transcript: Human NM_144984.4

Homo sapiens V-set and transmembrane domain containing 4 (VSTM4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
VSTM4 (196740)
Length:
2183
CDS:
38..613

Additional Resources:

NCBI RefSeq record:
NM_144984.4
NBCI Gene record:
VSTM4 (196740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144984.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138853 GTGGTGCAGTACTATGGGAAT pLKO.1 284 CDS 100% 4.050 2.835 N VSTM4 n/a
2 TRCN0000136371 CTTGATGGTGAAGATGACCAA pLKO.1 256 CDS 100% 2.640 1.584 N VSTM4 n/a
3 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1941 3UTR 100% 4.950 2.475 Y ERAP2 n/a
4 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1942 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144984.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09793 pDONR223 100% 55% 48.3% None (many diffs) n/a
2 ccsbBroad304_09793 pLX_304 0% 55% 48.3% V5 (many diffs) n/a
3 TRCN0000478079 ACTGGCAACTAAAAAACCGACCGT pLX_317 33.8% 55% 48.3% V5 (many diffs) n/a
Download CSV