Transcript: Human NM_145004.7

Homo sapiens ADAM metallopeptidase domain 32 (ADAM32), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ADAM32 (203102)
Length:
2524
CDS:
43..2406

Additional Resources:

NCBI RefSeq record:
NM_145004.7
NBCI Gene record:
ADAM32 (203102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145004.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052341 GCACGTTGTGAGAGTGTATTT pLKO.1 1540 CDS 100% 13.200 18.480 N ADAM32 n/a
2 TRCN0000052338 GCGAATCTAAATCGGAAGGTA pLKO.1 2201 CDS 100% 3.000 4.200 N ADAM32 n/a
3 TRCN0000052339 GCAAATTCAATGTTCACCCAA pLKO.1 700 CDS 100% 2.640 3.696 N ADAM32 n/a
4 TRCN0000052340 GCATAACTGTAGACTACAAAT pLKO.1 1778 CDS 100% 13.200 10.560 N ADAM32 n/a
5 TRCN0000429692 CAATGTGTATTACTCGTTATT pLKO_005 920 CDS 100% 13.200 9.240 N ADAM32 n/a
6 TRCN0000052342 GCAGCAGTCAAGCTGATACTA pLKO.1 2297 CDS 100% 5.625 3.938 N ADAM32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145004.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05208 pDONR223 100% 99.9% 99.8% None 1400C>G n/a
2 ccsbBroad304_05208 pLX_304 0% 99.9% 99.8% V5 1400C>G n/a
3 TRCN0000469709 TGGGGTACGGAGATATGGTCGTCT pLX_317 19.8% 99.9% 99.8% V5 1400C>G n/a
4 ccsbBroadEn_16122 pDONR223 0% 99.8% 99.6% None 293A>G;478A>G;1400C>G n/a
5 ccsbBroad304_16122 pLX_304 0% 99.8% 99.6% V5 293A>G;478A>G;1400C>G n/a
6 TRCN0000473039 CAAGTTCAAGTTGATTCGAACCAA pLX_317 16.8% 99.8% 99.6% V5 293A>G;478A>G;1400C>G n/a
Download CSV