Transcript: Human NM_145176.3

Homo sapiens solute carrier family 2 member 12 (SLC2A12), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SLC2A12 (154091)
Length:
5572
CDS:
145..1998

Additional Resources:

NCBI RefSeq record:
NM_145176.3
NBCI Gene record:
SLC2A12 (154091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042899 CGGCATTCTTTCTGCCTATAT pLKO.1 675 CDS 100% 13.200 18.480 N SLC2A12 n/a
2 TRCN0000042898 GCCCATATATTCTATCTAGAT pLKO.1 2481 3UTR 100% 4.950 6.930 N SLC2A12 n/a
3 TRCN0000042900 CCTTGCTAAATGCTGGATTAA pLKO.1 1451 CDS 100% 13.200 9.240 N SLC2A12 n/a
4 TRCN0000042901 CCCGAATAATGATAGGACTAA pLKO.1 974 CDS 100% 4.950 3.465 N SLC2A12 n/a
5 TRCN0000042902 CCCTGAGAAATGATGTGGATA pLKO.1 1406 CDS 100% 4.950 3.465 N SLC2A12 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5509 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09707 pDONR223 100% 99.9% 100% None 1023C>T n/a
2 ccsbBroad304_09707 pLX_304 0% 99.9% 100% V5 1023C>T n/a
3 TRCN0000473948 CCAGACTGTGGGTCATGGTATCGC pLX_317 18.7% 99.9% 100% V5 1023C>T n/a
Download CSV