Transcript: Human NM_145177.3

Homo sapiens dehydrogenase/reductase X-linked (DHRSX), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DHRSX (207063)
Length:
2579
CDS:
52..1044

Additional Resources:

NCBI RefSeq record:
NM_145177.3
NBCI Gene record:
DHRSX (207063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236106 ATTACCTATACAACGAGAAAG pLKO_005 926 CDS 100% 10.800 15.120 N DHRSX n/a
2 TRCN0000028116 CCTTCTCTTGGATACGCTGAA pLKO.1 531 CDS 100% 4.050 5.670 N DHRSX n/a
3 TRCN0000236107 GGACAGATGGCATTGGCTATT pLKO_005 203 CDS 100% 10.800 7.560 N DHRSX n/a
4 TRCN0000236108 TGACTTCCATCCGGCAGTTTG pLKO_005 368 CDS 100% 10.800 7.560 N DHRSX n/a
5 TRCN0000028103 GCATGTTATCATAGCTGGAAA pLKO.1 255 CDS 100% 4.950 3.465 N DHRSX n/a
6 TRCN0000028096 GCCAAACAAGTTGTAAGCAAA pLKO.1 289 CDS 100% 4.950 3.465 N DHRSX n/a
7 TRCN0000028090 GTGGTCTAAGAGTTGTGAGAT pLKO.1 996 CDS 100% 4.950 3.465 N DHRSX n/a
8 TRCN0000236104 TGTTATCATAGCTGGAAATAA pLKO_005 258 CDS 100% 15.000 9.000 N DHRSX n/a
9 TRCN0000236105 CCTAACCCTCAGAACCTATAA pLKO_005 1694 3UTR 100% 13.200 7.920 N DHRSX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09835 pDONR223 100% 99.7% 99.3% None 739G>C;875A>G n/a
2 ccsbBroad304_09835 pLX_304 0% 99.7% 99.3% V5 739G>C;875A>G n/a
3 TRCN0000467479 GCAATCGAACTCTACATGATCCCA pLX_317 45% 99.7% 99.3% V5 739G>C;875A>G n/a
Download CSV