Transcript: Human NM_145204.4

Homo sapiens SUMO peptidase family member, NEDD8 specific (SENP8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SENP8 (123228)
Length:
4178
CDS:
110..748

Additional Resources:

NCBI RefSeq record:
NM_145204.4
NBCI Gene record:
SENP8 (123228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073339 GCTGGCTCAATGACCATATTA pLKO.1 183 CDS 100% 15.000 21.000 N SENP8 n/a
2 TRCN0000073338 CCTAACTTCATTCAAGACCTA pLKO.1 1232 3UTR 100% 2.640 2.112 N SENP8 n/a
3 TRCN0000073341 CCCAACAAGAGAGTTGTATTT pLKO.1 350 CDS 100% 13.200 9.240 N SENP8 n/a
4 TRCN0000426887 CCTTATCCACATTGGCTTATT pLKO_005 1066 3UTR 100% 13.200 9.240 N SENP8 n/a
5 TRCN0000031040 CGGCAATCAGATGTCTCACTA pLKO.1 149 CDS 100% 4.950 3.465 N Senp8 n/a
6 TRCN0000073342 GACTGTGGGATGTACGTGATA pLKO.1 593 CDS 100% 4.950 3.465 N SENP8 n/a
7 TRCN0000436016 GTAGCTATTGAAGTATATTTG pLKO_005 745 CDS 100% 13.200 7.920 N SENP8 n/a
8 TRCN0000073340 CCCTGCATACATCACAAAGAA pLKO.1 682 CDS 100% 5.625 3.375 N SENP8 n/a
9 TRCN0000031043 CCATAGCAGGAGCAACTCAAT pLKO.1 469 CDS 100% 4.950 3.960 N Senp8 n/a
10 TRCN0000180546 GCCTGTAATCCCAGGACTTTA pLKO.1 3421 3UTR 100% 13.200 6.600 Y PRR11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09477 pDONR223 100% 99.8% 99.5% None 619A>G n/a
2 ccsbBroad304_09477 pLX_304 0% 99.8% 99.5% V5 619A>G n/a
3 TRCN0000475365 TACCCTGCGACCATACCCGATCTC pLX_317 62.6% 99.8% 99.5% V5 619A>G n/a
4 TRCN0000489313 ACCCTGCCAACCTACGGAAAACCC pLX_317 53.5% 99.8% 99.5% V5 (not translated due to prior stop codon) 619A>G n/a
Download CSV