Transcript: Mouse NM_145220.2

Mus musculus adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 (Appl2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Appl2 (216190)
Length:
2958
CDS:
84..2072

Additional Resources:

NCBI RefSeq record:
NM_145220.2
NBCI Gene record:
Appl2 (216190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375876 GGCTTCTTGTCATCCGTTAAA pLKO_005 753 CDS 100% 13.200 18.480 N Appl2 n/a
2 TRCN0000376823 TTCAGGCGGTGACGCCAATTA pLKO_005 1267 CDS 100% 13.200 18.480 N Appl2 n/a
3 TRCN0000217861 GTCAAACTCTGAGGTTGATAG pLKO.1 1699 CDS 100% 10.800 8.640 N Appl2 n/a
4 TRCN0000366945 AGAAGCACTGGCTCGATTAAT pLKO_005 1943 CDS 100% 15.000 10.500 N Appl2 n/a
5 TRCN0000366893 CAGTGGCAAACCGGGAATAAT pLKO_005 1124 CDS 100% 15.000 10.500 N Appl2 n/a
6 TRCN0000375940 GAGAAGGCGAAGACGGAAATT pLKO_005 552 CDS 100% 13.200 9.240 N Appl2 n/a
7 TRCN0000200411 GCGTGCCTACACTCTACAAAT pLKO.1 2255 3UTR 100% 13.200 9.240 N Appl2 n/a
8 TRCN0000200043 CCTTCCTCAAAGGGACCAATT pLKO.1 2712 3UTR 100% 10.800 7.560 N Appl2 n/a
9 TRCN0000375939 GAATTTAGAACACCGACAATC pLKO_005 2164 3UTR 100% 10.800 7.560 N Appl2 n/a
10 TRCN0000176873 GCGATGAAGAAGTAATTTCAA pLKO.1 316 CDS 100% 5.625 3.938 N Appl2 n/a
11 TRCN0000182426 GCTCCCTAAGAAGAAGGAGAA pLKO.1 530 CDS 100% 4.050 2.835 N Appl2 n/a
12 TRCN0000200320 GCAGATGTTCATCGTTCGGTT pLKO.1 1550 CDS 100% 2.640 1.848 N Appl2 n/a
13 TRCN0000181227 CCTGAAACAGAGGAACTGATT pLKO.1 1389 CDS 100% 4.950 2.970 N Appl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08489 pDONR223 100% 87.6% 92.3% None (many diffs) n/a
2 ccsbBroad304_08489 pLX_304 0% 87.6% 92.3% V5 (many diffs) n/a
3 TRCN0000481225 AGTAGTAGCAGAAGGTTCGGATTC pLX_317 18.7% 87.6% 92.3% V5 (many diffs) n/a
Download CSV