Transcript: Human NM_145287.4

Homo sapiens zinc finger protein 519 (ZNF519), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ZNF519 (162655)
Length:
6760
CDS:
159..1781

Additional Resources:

NCBI RefSeq record:
NM_145287.4
NBCI Gene record:
ZNF519 (162655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017938 GCTCCTACAGAACCATGTATT pLKO.1 558 CDS 100% 13.200 18.480 N ZNF519 n/a
2 TRCN0000420311 ATCACATCTAAAGGGACATAA pLKO_005 905 CDS 100% 13.200 9.240 N ZNF519 n/a
3 TRCN0000017940 CCCTGGCTGTGTATTCTTATT pLKO.1 283 CDS 100% 13.200 9.240 N ZNF519 n/a
4 TRCN0000415750 CAAGGCATACAAGATTCATTC pLKO_005 327 CDS 100% 10.800 7.560 N ZNF519 n/a
5 TRCN0000428578 GCCTTACAACTCTAATGAATG pLKO_005 779 CDS 100% 10.800 7.560 N ZNF519 n/a
6 TRCN0000415805 TAATTCATACCAGGTAGAAAC pLKO_005 1765 CDS 100% 10.800 7.560 N ZNF519 n/a
7 TRCN0000017941 CCATTCTCAAAGCTTACTCAA pLKO.1 816 CDS 100% 4.950 3.465 N ZNF519 n/a
8 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 175 CDS 100% 5.625 2.813 Y ZNF765 n/a
9 TRCN0000017939 CCTTACTCAACATCAGAGAAT pLKO.1 1160 CDS 100% 4.950 2.475 Y ZNF519 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4250 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09745 pDONR223 100% 99.8% 99.6% None 499A>G;616A>G n/a
2 ccsbBroad304_09745 pLX_304 0% 99.8% 99.6% V5 499A>G;616A>G n/a
3 TRCN0000468932 CATTACGGCACGGCCGCTTAAGTG pLX_317 25.9% 99.8% 99.6% V5 499A>G;616A>G n/a
Download CSV