Transcript: Mouse NM_145355.5

Mus musculus ring finger protein 185 (Rnf185), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rnf185 (193670)
Length:
3508
CDS:
805..1491

Additional Resources:

NCBI RefSeq record:
NM_145355.5
NBCI Gene record:
Rnf185 (193670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145355.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040758 GCCGTGTTTACATCAGTGGTT pLKO.1 1092 CDS 100% 2.640 3.696 N Rnf185 n/a
2 TRCN0000040759 GCCACAGCATTTAACATAAAT pLKO.1 1354 CDS 100% 15.000 12.000 N Rnf185 n/a
3 TRCN0000317877 GCCACAGCATTTAACATAAAT pLKO_005 1354 CDS 100% 15.000 12.000 N Rnf185 n/a
4 TRCN0000314036 GGATGAACCAAATGGTATTTA pLKO_005 1819 3UTR 100% 15.000 12.000 N Rnf185 n/a
5 TRCN0000040761 GACTGGGATTGTCTTGAGAAT pLKO.1 862 CDS 100% 4.950 3.960 N Rnf185 n/a
6 TRCN0000034056 GTTTACATCAGTGGTTGGAGA pLKO.1 1097 CDS 100% 2.640 2.112 N RNF185 n/a
7 TRCN0000350041 CTCTTCTGTTGGCCGTGTTTA pLKO_005 1081 CDS 100% 13.200 9.240 N Rnf185 n/a
8 TRCN0000040760 GCACCTTTGAGTGCAACATAT pLKO.1 1016 CDS 100% 13.200 9.240 N Rnf185 n/a
9 TRCN0000314037 TGGCTCCTGATCGCCTAATAC pLKO_005 1474 CDS 100% 13.200 9.240 N Rnf185 n/a
10 TRCN0000040762 GAGCATTTCCATTTGGGATAT pLKO.1 1331 CDS 100% 10.800 7.560 N Rnf185 n/a
11 TRCN0000317876 GAGCATTTCCATTTGGGATAT pLKO_005 1331 CDS 100% 10.800 7.560 N Rnf185 n/a
12 TRCN0000034055 CCTCTTCTGTTGGCCGTGTTT pLKO.1 1080 CDS 100% 4.950 3.465 N RNF185 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145355.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04546 pDONR223 100% 78.3% 82.8% None (many diffs) n/a
2 ccsbBroad304_04546 pLX_304 0% 78.3% 82.8% V5 (many diffs) n/a
3 TRCN0000471609 CCAATCCGCCACAACTATGGTCAA pLX_317 62.9% 78.3% 82.8% V5 (many diffs) n/a
Download CSV