Transcript: Mouse NM_145470.3

Mus musculus DEP domain containing MTOR-interacting protein (Deptor), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Deptor (97998)
Length:
8549
CDS:
182..1411

Additional Resources:

NCBI RefSeq record:
NM_145470.3
NBCI Gene record:
Deptor (97998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145470.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295665 TGACCGAGAGACGGCGATAAA pLKO_005 421 CDS 100% 13.200 18.480 N Deptor n/a
2 TRCN0000295608 GTTTAGAGTTCTCAATCATTG pLKO_005 1795 3UTR 100% 10.800 15.120 N Deptor n/a
3 TRCN0000110157 CGCAAGGAAGACATTCACGAT pLKO.1 1159 CDS 100% 2.640 3.696 N Deptor n/a
4 TRCN0000110158 GTCGGAAATCTACCAGCTTTA pLKO.1 945 CDS 100% 10.800 7.560 N Deptor n/a
5 TRCN0000288337 GTCGGAAATCTACCAGCTTTA pLKO_005 945 CDS 100% 10.800 7.560 N Deptor n/a
6 TRCN0000110156 GCATGGCTGAAGTCCTAGTTA pLKO.1 267 CDS 100% 5.625 3.938 N Deptor n/a
7 TRCN0000288336 GCATGGCTGAAGTCCTAGTTA pLKO_005 267 CDS 100% 5.625 3.938 N Deptor n/a
8 TRCN0000110155 CGCTGTTTGAATGTGGAAGAA pLKO.1 1541 3UTR 100% 4.950 3.465 N Deptor n/a
9 TRCN0000327062 CGCTGTTTGAATGTGGAAGAA pLKO_005 1541 3UTR 100% 4.950 3.465 N Deptor n/a
10 TRCN0000110159 GCAAGGAAGACATTCACGATT pLKO.1 1160 CDS 100% 4.950 3.465 N Deptor n/a
11 TRCN0000168393 GCAAGGAAGACATTCACGATT pLKO.1 1160 CDS 100% 4.950 3.465 N DEPTOR n/a
12 TRCN0000288335 GCAAGGAAGACATTCACGATT pLKO_005 1160 CDS 100% 4.950 3.465 N Deptor n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145470.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15973 pDONR223 0% 89.9% 95.8% None (many diffs) n/a
2 ccsbBroad304_15973 pLX_304 0% 89.9% 95.8% V5 (many diffs) n/a
Download CSV