Transcript: Mouse NM_145480.1

Mus musculus replication factor C (activator 1) 4 (Rfc4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rfc4 (106344)
Length:
1231
CDS:
58..1152

Additional Resources:

NCBI RefSeq record:
NM_145480.1
NBCI Gene record:
Rfc4 (106344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111397 GCTGCAACCATTGATGGAATA pLKO.1 868 CDS 100% 10.800 7.560 N Rfc4 n/a
2 TRCN0000111398 CCTCTGTCAGATAAGATTCAA pLKO.1 658 CDS 100% 5.625 3.938 N Rfc4 n/a
3 TRCN0000111396 CGGAAAGCCATCACATTTCTT pLKO.1 772 CDS 100% 5.625 3.938 N Rfc4 n/a
4 TRCN0000111399 GTCCTCCCTTTAAGATTGTAA pLKO.1 479 CDS 100% 5.625 3.938 N Rfc4 n/a
5 TRCN0000111395 GCTGTGGTAAAGAACCTCATA pLKO.1 928 CDS 100% 4.950 3.465 N Rfc4 n/a
6 TRCN0000074233 GCATCTGATGAACGTGGAATA pLKO.1 385 CDS 100% 10.800 6.480 N RFC4 n/a
7 TRCN0000331461 GCATCTGATGAACGTGGAATA pLKO_005 385 CDS 100% 10.800 6.480 N RFC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06857 pDONR223 100% 86.9% 90.9% None (many diffs) n/a
2 ccsbBroad304_06857 pLX_304 0% 86.9% 90.9% V5 (many diffs) n/a
3 TRCN0000472875 CTCCCTATCTCTTAGGGTCGCCCT pLX_317 50.6% 86.9% 90.9% V5 (many diffs) n/a
Download CSV