Transcript: Mouse NM_145529.3

Mus musculus cleavage stimulation factor, 3' pre-RNA, subunit 3 (Cstf3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cstf3 (228410)
Length:
2852
CDS:
193..2346

Additional Resources:

NCBI RefSeq record:
NM_145529.3
NBCI Gene record:
Cstf3 (228410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337867 ATACGATGAGTCGGCTTAAAC pLKO_005 2338 CDS 100% 13.200 18.480 N Cstf3 n/a
2 TRCN0000120944 GTCAGAGAAACCAAGGGTAAA pLKO.1 514 CDS 100% 10.800 15.120 N Cstf3 n/a
3 TRCN0000337863 GTCAGAGAAACCAAGGGTAAA pLKO_005 514 CDS 100% 10.800 15.120 N Cstf3 n/a
4 TRCN0000120943 GCCAAGTTATTTAGTGACGAA pLKO.1 1141 CDS 100% 2.640 3.696 N Cstf3 n/a
5 TRCN0000337864 GCCAAGTTATTTAGTGACGAA pLKO_005 1141 CDS 100% 2.640 3.696 N Cstf3 n/a
6 TRCN0000075037 CCGAAGATGCAAGATACCAAA pLKO.1 2121 CDS 100% 4.950 3.960 N CSTF3 n/a
7 TRCN0000286171 CCGAAGATGCAAGATACCAAA pLKO_005 2121 CDS 100% 4.950 3.960 N CSTF3 n/a
8 TRCN0000120945 CACCTCAATGAGGACAATAAT pLKO.1 1558 CDS 100% 15.000 10.500 N Cstf3 n/a
9 TRCN0000120942 CCTATCCTCTAAGCAAGATTA pLKO.1 2543 3UTR 100% 13.200 9.240 N Cstf3 n/a
10 TRCN0000337866 CCTATCCTCTAAGCAAGATTA pLKO_005 2543 3UTR 100% 13.200 9.240 N Cstf3 n/a
11 TRCN0000075035 CCTATCAGATTTGGGTGGATT pLKO.1 608 CDS 100% 4.950 3.465 N CSTF3 n/a
12 TRCN0000120946 CCAGACACTCAGCAGATGATT pLKO.1 1942 CDS 100% 5.625 3.375 N Cstf3 n/a
13 TRCN0000337865 CCAGACACTCAGCAGATGATT pLKO_005 1942 CDS 100% 5.625 3.375 N Cstf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13838 pDONR223 100% 12.9% .9% None (many diffs) n/a
2 ccsbBroad304_13838 pLX_304 0% 12.9% .9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000465550 GCCTACCGAGGCATGCGCGGTGGC pLX_317 97.8% 12.9% .9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV