Transcript: Human NM_145638.3

Homo sapiens oxysterol binding protein like 5 (OSBPL5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
OSBPL5 (114879)
Length:
3643
CDS:
110..2545

Additional Resources:

NCBI RefSeq record:
NM_145638.3
NBCI Gene record:
OSBPL5 (114879)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147951 GCCTTAATGCTAAAGCCAAAT pLKO.1 2769 3UTR 100% 10.800 15.120 N OSBPL5 n/a
2 TRCN0000426073 ACCATCGAGTGTGCGAAGAAC pLKO_005 1571 CDS 100% 4.950 6.930 N OSBPL5 n/a
3 TRCN0000180915 GAACAAGCTCTCCGACTACTA pLKO.1 1105 CDS 100% 4.950 6.930 N OSBPL5 n/a
4 TRCN0000416188 GAATCCTGTATGGCACGATGA pLKO_005 1527 CDS 100% 4.050 5.670 N OSBPL5 n/a
5 TRCN0000430636 ACAGCCGCACATTCTACATAG pLKO_005 1302 CDS 100% 10.800 7.560 N OSBPL5 n/a
6 TRCN0000433763 AGCCGAGGATTACACCCTTAC pLKO_005 1483 CDS 100% 6.000 4.200 N OSBPL5 n/a
7 TRCN0000426227 CAACGGGTCAGACAAGGAATG pLKO_005 346 CDS 100% 6.000 4.200 N OSBPL5 n/a
8 TRCN0000148084 GTTCATTAACCACATCCTCAA pLKO.1 2521 CDS 100% 4.050 2.835 N OSBPL5 n/a
9 TRCN0000180071 CAAGGGAATCAAGAAGCCGTA pLKO.1 1228 CDS 100% 2.160 1.512 N OSBPL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16078 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16078 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474335 GTCTCCCAAGACACACCTTCGAAC pLX_317 15.7% 100% 100% V5 n/a
4 ccsbBroadEn_04664 pDONR223 100% 92.2% 92.2% None 397_398ins204 n/a
5 ccsbBroad304_04664 pLX_304 0% 92.2% 92.2% V5 397_398ins204 n/a
6 TRCN0000470065 ACGGAACTTAACTCCTAGGGTGTT pLX_317 15.7% 92.2% 92.2% V5 397_398ins204 n/a
Download CSV