Transcript: Human NM_145658.4

Homo sapiens sperm equatorial segment protein 1 (SPESP1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SPESP1 (246777)
Length:
1406
CDS:
130..1182

Additional Resources:

NCBI RefSeq record:
NM_145658.4
NBCI Gene record:
SPESP1 (246777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145658.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152155 CAAGAATGTTGCCAGTTGTTA pLKO.1 605 CDS 100% 5.625 7.875 N SPESP1 n/a
2 TRCN0000153616 CTGGTCGATCAAACCAAACAA pLKO.1 492 CDS 100% 5.625 7.875 N SPESP1 n/a
3 TRCN0000153084 GAGAACCTAGTACGAAGTGTT pLKO.1 250 CDS 100% 4.950 6.930 N SPESP1 n/a
4 TRCN0000153995 CGCTTCAACTGAGAATGATGT pLKO.1 375 CDS 100% 4.950 3.960 N SPESP1 n/a
5 TRCN0000154070 CAGGTGAAACTGCGATAGAAA pLKO.1 737 CDS 100% 5.625 3.938 N SPESP1 n/a
6 TRCN0000152349 CCAGAGAGTTGGAATAATGAT pLKO.1 781 CDS 100% 5.625 3.938 N SPESP1 n/a
7 TRCN0000153506 CCAAGAATGTTGCCAGTTGTT pLKO.1 604 CDS 100% 4.950 3.465 N SPESP1 n/a
8 TRCN0000150324 CCAGTTGTTACTGAATCATCT pLKO.1 616 CDS 100% 4.950 3.465 N SPESP1 n/a
9 TRCN0000152885 GCATTGGGATCTCTACAGAAT pLKO.1 695 CDS 100% 4.950 3.465 N SPESP1 n/a
10 TRCN0000152374 CTGAATCATCTACAAGTCCAT pLKO.1 626 CDS 100% 2.640 1.848 N SPESP1 n/a
11 TRCN0000152572 GAAGCCTCTAAAGATCACCTA pLKO.1 892 CDS 100% 2.640 1.848 N SPESP1 n/a
12 TRCN0000151237 GCTGATTTAAGCAAACTGCAT pLKO.1 1228 3UTR 100% 2.640 1.848 N SPESP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145658.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05286 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05286 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465825 GCGTCCCAGAGCGCATCTACATGG pLX_317 35.6% 100% 100% V5 n/a
Download CSV