Transcript: Human NM_145898.4

Homo sapiens C-C motif chemokine ligand 23 (CCL23), transcript variant CKbeta8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CCL23 (6368)
Length:
577
CDS:
76..438

Additional Resources:

NCBI RefSeq record:
NM_145898.4
NBCI Gene record:
CCL23 (6368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145898.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371676 CACTCCTGGAGAGTTACTTTG pLKO_005 272 CDS 100% 10.800 7.560 N CCL23 n/a
2 TRCN0000371677 GAAGCTGGACACACGGATCAA pLKO_005 402 CDS 100% 4.950 3.465 N CCL23 n/a
3 TRCN0000057868 TGTCAAGGTGAAGGGACACAA pLKO.1 442 3UTR 100% 4.950 3.465 N CCL23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145898.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06921 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_06921 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480812 GCTTCGGCTGTTAAGTCCGCCTTC pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_06919 pDONR223 100% 81.8% 68.3% None (many diffs) n/a
5 ccsbBroad304_06919 pLX_304 0% 81.8% 68.3% V5 (many diffs) n/a
6 TRCN0000475632 GAGATCTTCCTTTCGAATGGCGTT pLX_317 81.7% 81.8% 68.3% V5 (many diffs) n/a
Download CSV