Transcript: Mouse NM_145922.3

Mus musculus potassium voltage gated channel, Shaw-related subfamily, member 4 (Kcnc4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-26
Taxon:
Mus musculus (mouse)
Gene:
Kcnc4 (99738)
Length:
3015
CDS:
9..1895

Additional Resources:

NCBI RefSeq record:
NM_145922.3
NBCI Gene record:
Kcnc4 (99738)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145922.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044941 CGTCGGAGAAGATCATCATCA pLKO.1 109 CDS 100% 4.950 6.930 N KCNC4 n/a
2 TRCN0000069033 CGTCAATAACTTTGGTATGTA pLKO.1 1433 CDS 100% 5.625 4.500 N Kcnc4 n/a
3 TRCN0000069034 GAAGGCAATGTTGAGCCGAAA pLKO.1 1839 CDS 100% 4.050 3.240 N Kcnc4 n/a
4 TRCN0000044942 GACTCTAAGCAGAATGGCGAT pLKO.1 1635 CDS 100% 2.160 1.728 N KCNC4 n/a
5 TRCN0000069036 CCTGTCATCGTCAATAACTTT pLKO.1 1425 CDS 100% 5.625 3.938 N Kcnc4 n/a
6 TRCN0000069037 CGAAACGTGACGGAGATTCAT pLKO.1 783 CDS 100% 5.625 3.938 N Kcnc4 n/a
7 TRCN0000069035 GTCGGAGAAGATCATCATCAA pLKO.1 110 CDS 100% 4.950 3.465 N Kcnc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145922.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488393 CCCAGCTCGCCGCAGATGCAGCCA pLX_317 18.7% 85.3% 93.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487938 CACTCCCCATTACGCCACTCGACG pLX_317 16.8% 85.3% 92.9% V5 (many diffs) n/a
3 ccsbBroadEn_10931 pDONR223 100% 81.2% 81.4% None (many diffs) n/a
4 ccsbBroad304_10931 pLX_304 0% 81.2% 81.4% V5 (many diffs) n/a
5 TRCN0000477692 ATGTGGAAGGGACAAGAACCGTAC pLX_317 23.5% 81.2% 81.4% V5 (many diffs) n/a
Download CSV