Transcript: Mouse NM_145942.5

Mus musculus 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (Hmgcs1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hmgcs1 (208715)
Length:
3577
CDS:
233..1795

Additional Resources:

NCBI RefSeq record:
NM_145942.5
NBCI Gene record:
Hmgcs1 (208715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145942.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076046 CCTTCTCAATATGTCGATCAA pLKO.1 311 CDS 100% 4.950 6.930 N Hmgcs1 n/a
2 TRCN0000413039 GAAATCAGTGAAGTCTAATTT pLKO_005 535 CDS 100% 15.000 10.500 N Hmgcs1 n/a
3 TRCN0000418756 CAGAGACAATCATCGACAAAT pLKO_005 513 CDS 100% 13.200 9.240 N Hmgcs1 n/a
4 TRCN0000218729 GATCTTTCACTCACCATATTG pLKO_005 1015 CDS 100% 13.200 9.240 N HMGCS1 n/a
5 TRCN0000412510 GATCTTTCACTCACCATATTG pLKO_005 1015 CDS 100% 13.200 9.240 N Hmgcs1 n/a
6 TRCN0000076045 GCAAGTTTATGTGACCTTAAA pLKO.1 1439 CDS 100% 13.200 9.240 N Hmgcs1 n/a
7 TRCN0000076044 GCGTCTTTGCTTGTGTCTAAT pLKO.1 1229 CDS 100% 13.200 9.240 N Hmgcs1 n/a
8 TRCN0000440960 AGCTCTTGGGATGGACGATAT pLKO_005 668 CDS 100% 10.800 7.560 N Hmgcs1 n/a
9 TRCN0000076047 CCTTCACAAATGACCACAGTT pLKO.1 1641 CDS 100% 4.950 3.465 N Hmgcs1 n/a
10 TRCN0000076043 GCAGATTATGTGTTGCTTAAA pLKO.1 1877 3UTR 100% 13.200 7.920 N Hmgcs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145942.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.