Transcript: Mouse NM_145983.2

Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 5 (Kcna5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kcna5 (16493)
Length:
3032
CDS:
393..2201

Additional Resources:

NCBI RefSeq record:
NM_145983.2
NBCI Gene record:
Kcna5 (16493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069243 GCAGAGGGATAACTCAAACAA pLKO.1 2502 3UTR 100% 5.625 3.938 N Kcna5 n/a
2 TRCN0000069246 CCTGGAGAGTACTGACAGTAT pLKO.1 2066 CDS 100% 4.950 3.465 N Kcna5 n/a
3 TRCN0000069244 GCTACTTCGATCCCTTGAGAA pLKO.1 826 CDS 100% 4.950 3.465 N Kcna5 n/a
4 TRCN0000069247 CCAAAGAAACATCACCGAGGA pLKO.1 529 CDS 100% 2.160 1.512 N Kcna5 n/a
5 TRCN0000069245 GCAGAATTCTCTCGGAATATT pLKO.1 1413 CDS 100% 0.000 0.000 N Kcna5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06471 pDONR223 100% 82.9% 86.3% None (many diffs) n/a
2 ccsbBroad304_06471 pLX_304 0% 82.9% 86.3% V5 (many diffs) n/a
3 TRCN0000471284 GGAGCCCATACCGCGCTTTTCGTA pLX_317 20.8% 82.9% 86.3% V5 (many diffs) n/a
Download CSV