Transcript: Mouse NM_146032.3

Mus musculus signal recognition particle 68 (Srp68), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Srp68 (217337)
Length:
2546
CDS:
112..1989

Additional Resources:

NCBI RefSeq record:
NM_146032.3
NBCI Gene record:
Srp68 (217337)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313639 TACGACAGAGTTCTCAAATAT pLKO_005 1564 CDS 100% 15.000 21.000 N Srp68 n/a
2 TRCN0000123791 CCTGTACGACAGAGTTCTCAA pLKO.1 1560 CDS 100% 4.950 3.960 N Srp68 n/a
3 TRCN0000123789 CCGACAAGTTCCATGGCATTA pLKO.1 2044 3UTR 100% 10.800 7.560 N Srp68 n/a
4 TRCN0000317214 CCGACAAGTTCCATGGCATTA pLKO_005 2044 3UTR 100% 10.800 7.560 N Srp68 n/a
5 TRCN0000349979 GCTACTGTGCATACAACATTG pLKO_005 842 CDS 100% 10.800 7.560 N Srp68 n/a
6 TRCN0000313689 TCCGGCTCTATGACATCATTC pLKO_005 1382 CDS 100% 10.800 7.560 N Srp68 n/a
7 TRCN0000123790 CCTGACTGATAACAGATACTT pLKO.1 459 CDS 100% 5.625 3.938 N Srp68 n/a
8 TRCN0000123793 AGGCTACATCAAGGGCATCTT pLKO.1 1953 CDS 100% 4.950 3.465 N Srp68 n/a
9 TRCN0000123792 CTCATCAAACAGACACCTCAT pLKO.1 1721 CDS 100% 4.050 2.835 N Srp68 n/a
10 TRCN0000349980 TGGAGATTCTGCAGATCATTA pLKO_005 287 CDS 100% 13.200 7.920 N Srp68 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11157 pDONR223 100% 83.3% 90.5% None (many diffs) n/a
2 ccsbBroad304_11157 pLX_304 0% 83.3% 90.5% V5 (many diffs) n/a
3 TRCN0000481598 CGGAAATTTTAATACATTGATGGG pLX_317 26.3% 83.3% 90.5% V5 (many diffs) n/a
Download CSV