Transcript: Mouse NM_146054.2

Mus musculus fermitin family member 2 (Fermt2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Fermt2 (218952)
Length:
3243
CDS:
143..2185

Additional Resources:

NCBI RefSeq record:
NM_146054.2
NBCI Gene record:
Fermt2 (218952)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190504 GCCTACCTTGATATGCCGTAT pLKO.1 2360 3UTR 100% 4.050 5.670 N Fermt2 n/a
2 TRCN0000298115 GCCTACCTTGATATGCCGTAT pLKO_005 2360 3UTR 100% 4.050 5.670 N Fermt2 n/a
3 TRCN0000191858 GCCTTTGTGTTACAATATGAA pLKO.1 2799 3UTR 100% 5.625 3.938 N Fermt2 n/a
4 TRCN0000298126 GCCTTTGTGTTACAATATGAA pLKO_005 2799 3UTR 100% 5.625 3.938 N Fermt2 n/a
5 TRCN0000200833 GAAGTATAAGAGCAAACAGAT pLKO.1 1726 CDS 100% 4.950 3.465 N Fermt2 n/a
6 TRCN0000298130 GAAGTATAAGAGCAAACAGAT pLKO_005 1726 CDS 100% 4.950 3.465 N Fermt2 n/a
7 TRCN0000191859 GATGAGGAGATGTTCTACAAA pLKO.1 2144 CDS 100% 5.625 3.375 N Fermt2 n/a
8 TRCN0000293060 GATGAGGAGATGTTCTACAAA pLKO_005 2144 CDS 100% 5.625 3.375 N Fermt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07718 pDONR223 100% 89.4% 98.2% None (many diffs) n/a
2 ccsbBroad304_07718 pLX_304 0% 89.4% 98.2% V5 (many diffs) n/a
3 TRCN0000468260 TCCGCGATCCCTGGATCACATGCA pLX_317 13% 89.4% 98.2% V5 (many diffs) n/a
Download CSV