Transcript: Mouse NM_146103.2

Mus musculus transmembrane protein 185B (Tmem185b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem185b (226351)
Length:
2830
CDS:
358..1410

Additional Resources:

NCBI RefSeq record:
NM_146103.2
NBCI Gene record:
Tmem185b (226351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250600 ACAATACGTTCTCTTACATTT pLKO_005 1070 CDS 100% 13.200 18.480 N Tmem185b n/a
2 TRCN0000250602 TTTATACACTGCTAGTCTAAA pLKO_005 1770 3UTR 100% 13.200 18.480 N Tmem185b n/a
3 TRCN0000193183 CACAATACGTTCTCTTACATT pLKO.1 1069 CDS 100% 5.625 7.875 N Tmem185b n/a
4 TRCN0000250599 TTCCGACACGACAGGTCTTTG pLKO_005 757 CDS 100% 10.800 7.560 N Tmem185b n/a
5 TRCN0000250601 GCCTCCACCTCCCAAGTTAAA pLKO_005 1371 CDS 100% 13.200 7.920 N Tmem185b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10518 pDONR223 100% 88.8% 96% None (many diffs) n/a
2 ccsbBroad304_10518 pLX_304 0% 88.8% 96% V5 (many diffs) n/a
3 TRCN0000475283 TATGCATTGACCTGAGATATCGAT pLX_317 43.1% 88.8% 96% V5 (many diffs) n/a
Download CSV