Transcript: Mouse NM_146230.3

Mus musculus acetyl-Coenzyme A acyltransferase 1B (Acaa1b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Acaa1b (235674)
Length:
1669
CDS:
100..1374

Additional Resources:

NCBI RefSeq record:
NM_146230.3
NBCI Gene record:
Acaa1b (235674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248124 GAGGGAACCATGGGAATATTT pLKO_005 572 CDS 100% 15.000 10.500 N Acaa1b n/a
2 TRCN0000248121 GTGTCACAGCACTTTAATTTA pLKO_005 1475 3UTR 100% 15.000 9.000 N Acaa1b n/a
3 TRCN0000217733 GGCATCAGAAATGGGTCTTAT pLKO.1 505 CDS 100% 13.200 6.600 Y Acaa1a n/a
4 TRCN0000246455 GGCATCAGAAATGGGTCTTAT pLKO_005 505 CDS 100% 13.200 6.600 Y Acaa1a n/a
5 TRCN0000248120 AGGTTGTCACGCTACTCAATG pLKO_005 1256 CDS 100% 10.800 5.400 Y Acaa1b n/a
6 TRCN0000248122 GCATCAGAAATGGGTCTTATG pLKO_005 506 CDS 100% 10.800 5.400 Y Acaa1b n/a
7 TRCN0000248123 GGCTGACTGTGAATGACATAG pLKO_005 1097 CDS 100% 10.800 5.400 Y Acaa1b n/a
8 TRCN0000246458 TAGACATCTTTGAGATCAATG pLKO_005 1115 CDS 100% 10.800 5.400 Y Acaa1a n/a
9 TRCN0000183604 GTGAATGACATAGACATCTTT pLKO.1 1105 CDS 100% 5.625 2.813 Y Acaa1a n/a
10 TRCN0000183840 CATAGACATCTTTGAGATCAA pLKO.1 1113 CDS 100% 4.950 2.475 Y Acaa1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00004 pDONR223 100% 85.5% 85.8% None (many diffs) n/a
2 TRCN0000479705 CATTGCATGACGAAACGACATTCC pLX_317 24.5% 85.5% 85.8% V5 (many diffs) n/a
3 ccsbBroadEn_05756 pDONR223 100% 66.1% 66% None (many diffs) n/a
4 ccsbBroad304_05756 pLX_304 0% 66.1% 66% V5 (many diffs) n/a
5 TRCN0000474186 TGTATAACCACATTTATCGGGCTC pLX_317 51.8% 66.1% 66% V5 (many diffs) n/a
Download CSV