Transcript: Mouse NM_146260.2

Mus musculus transmembrane inner ear (Tmie), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmie (20776)
Length:
2437
CDS:
1162..1623

Additional Resources:

NCBI RefSeq record:
NM_146260.2
NBCI Gene record:
Tmie (20776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124529 CGCCTCAAATAGCAAGGAGAT pLKO.1 2072 3UTR 100% 4.050 5.670 N Tmie n/a
2 TRCN0000124532 CATCACGCTATGCTGTGTCTT pLKO.1 1377 CDS 100% 4.950 3.465 N Tmie n/a
3 TRCN0000124530 CCCTTAATGAACTCACAGAAA pLKO.1 1496 CDS 100% 4.950 3.465 N Tmie n/a
4 TRCN0000124531 GCTCTTCGTGTTGTCCATCAT pLKO.1 1356 CDS 100% 4.950 3.465 N Tmie n/a
5 TRCN0000124533 GCCAAGAAGAAAGGAGAGAAA pLKO.1 1600 CDS 100% 4.950 2.970 N Tmie n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13487 pDONR223 100% 87.8% 91.6% None (many diffs) n/a
2 ccsbBroad304_13487 pLX_304 0% 87.8% 91.6% V5 (many diffs) n/a
3 TRCN0000479846 GAATGACCACGAACGTCGTGGGAA pLX_317 71.9% 87.8% 91.6% V5 (many diffs) n/a
Download CSV