Transcript: Mouse NM_146265.2

Mus musculus olfactory receptor 1506 (Olfr1506), mRNA.

Source:
NCBI, updated 2018-05-29
Taxon:
Mus musculus (mouse)
Gene:
Olfr1506 (257665)
Length:
1084
CDS:
155..1084

Additional Resources:

NCBI RefSeq record:
NM_146265.2
NBCI Gene record:
Olfr1506 (257665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220937 CCCAATATCATTGACCATTAT pLKO.1 659 CDS 100% 13.200 6.600 Y Olfr1274-ps n/a
2 TRCN0000220945 CTCATTGGTCTGCTGATTGTT pLKO.1 728 CDS 100% 5.625 2.813 Y Olfr1506 n/a
3 TRCN0000220944 CTGGGACTCTCTTCTAATCAA pLKO.1 191 CDS 100% 5.625 2.813 Y Olfr1506 n/a
4 TRCN0000220939 GCACCCTGTGTCTTCATCTAT pLKO.1 902 CDS 100% 5.625 2.813 Y Olfr1274-ps n/a
5 TRCN0000220940 GCCATTGTGCTTGGGAATCTT pLKO.1 257 CDS 100% 5.625 2.813 Y Olfr1274-ps n/a
6 TRCN0000220946 GTGCTTCCTGTGCTTAAACTT pLKO.1 689 CDS 100% 5.625 2.813 Y Olfr1506 n/a
7 TRCN0000220953 CATGTCACTGTGGTTGTCATA pLKO.1 875 CDS 100% 4.950 2.475 Y Olfr1274-ps n/a
8 TRCN0000220938 GCAGAGAGTTTGCTTTGTGAT pLKO.1 217 CDS 100% 4.950 2.475 Y Olfr1274-ps n/a
9 TRCN0000220954 GTGATGTGCTTCCTGTGCTTA pLKO.1 684 CDS 100% 4.950 2.475 Y Olfr1274-ps n/a
10 TRCN0000220942 GTGGTCCTCTTATCATCCTAT pLKO.1 782 CDS 100% 4.950 2.475 Y Olfr1506 n/a
11 TRCN0000220943 TCATCTTGTTTCACCTGAGAA pLKO.1 807 CDS 100% 4.950 2.475 Y Olfr1506 n/a
12 TRCN0000220952 CCTTGTAGGAATGGCATGGAT pLKO.1 577 CDS 100% 3.000 1.500 Y Olfr1274-ps n/a
13 TRCN0000220955 CATGCACTTCTTTGGTGGCAT pLKO.1 457 CDS 100% 2.640 1.320 Y Olfr1274-ps n/a
14 TRCN0000220941 GCATTGAGATGTTCCTGCTTA pLKO.1 474 CDS 100% 4.950 2.475 Y Olfr1274-ps n/a
15 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 321 CDS 100% 4.950 2.475 Y OR10A2 n/a
16 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 320 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.