Transcript: Mouse NM_148938.3

Mus musculus solute carrier family 1 (glial high affinity glutamate transporter), member 3 (Slc1a3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc1a3 (20512)
Length:
4214
CDS:
567..2198

Additional Resources:

NCBI RefSeq record:
NM_148938.3
NBCI Gene record:
Slc1a3 (20512)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431155 GTTTCGATATTACCAATTTAG pLKO_005 2440 3UTR 100% 13.200 18.480 N Slc1a3 n/a
2 TRCN0000009914 GGTCGCGGTGATAATGTGGTA pLKO.1 1409 CDS 100% 2.640 3.696 N Slc1a3 n/a
3 TRCN0000420349 ACAACTTGATGAGCAATTATC pLKO_005 2601 3UTR 100% 13.200 9.240 N Slc1a3 n/a
4 TRCN0000009922 ATTTGCCCTCCGACCGTATAA pLKO.1 761 CDS 100% 13.200 9.240 N Slc1a3 n/a
5 TRCN0000414023 TGCTGTGGTGATTGGCATAAT pLKO_005 965 CDS 100% 13.200 9.240 N Slc1a3 n/a
6 TRCN0000009915 TGCCACCCTACCCATCACTTT pLKO.1 1664 CDS 100% 4.950 3.465 N Slc1a3 n/a
7 TRCN0000009923 TGCCTATCCAGTCCAACGAAA pLKO.1 1168 CDS 100% 4.950 3.465 N Slc1a3 n/a
8 TRCN0000009924 CCATGTGCTTCGGTTTCGTGA pLKO.1 1315 CDS 100% 2.640 1.848 N Slc1a3 n/a
9 TRCN0000043195 GCCTGCTTTAAACAGTTTAAA pLKO.1 1119 CDS 100% 1.500 0.900 N SLC1A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06955 pDONR223 100% 88.8% 96.3% None (many diffs) n/a
2 ccsbBroad304_06955 pLX_304 0% 88.8% 96.3% V5 (many diffs) n/a
Download CSV