Transcript: Mouse NM_152220.2

Mus musculus syntaxin 3 (Stx3), transcript variant A, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Stx3 (20908)
Length:
3271
CDS:
683..1552

Additional Resources:

NCBI RefSeq record:
NM_152220.2
NBCI Gene record:
Stx3 (20908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340240 AGGAAACACGGCTCAACATTG pLKO_005 801 CDS 100% 10.800 15.120 N Stx3 n/a
2 TRCN0000351114 CATCCAACGGCAGCTTGAAAT pLKO_005 1126 CDS 100% 13.200 9.240 N Stx3 n/a
3 TRCN0000381734 ACACGGACGAGGTTGAGATTG pLKO_005 735 CDS 100% 10.800 7.560 N Stx3 n/a
4 TRCN0000380739 AGGTGATGACAAAGTACAATG pLKO_005 1068 CDS 100% 10.800 7.560 N Stx3 n/a
5 TRCN0000340167 TCTTCACTTCTGGGATCATTG pLKO_005 1209 CDS 100% 10.800 7.560 N Stx3 n/a
6 TRCN0000110512 GCTTGAAATTACTGGCAAGAA pLKO.1 1138 CDS 100% 4.950 3.465 N Stx3 n/a
7 TRCN0000110513 GACGAGGTTGAGATTGCCATT pLKO.1 740 CDS 100% 4.050 2.835 N Stx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01616 pDONR223 100% 91.6% 97.9% None (many diffs) n/a
2 ccsbBroad304_01616 pLX_304 0% 91.6% 97.9% V5 (many diffs) n/a
3 TRCN0000474779 AGGTACGACCTCGACTATGCATTC pLX_317 11.4% 91.6% 97.9% V5 (many diffs) n/a
Download CSV