Construct: ORF TRCN0000474779
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001418.1_s317c1
- Derived from:
- ccsbBroadEn_01616
- DNA Barcode:
- AGGTACGACCTCGACTATGCATTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- STX3 (6809)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474779
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6809 | STX3 | syntaxin 3 | NM_004177.5 | 100% | 100% | |
| 2 | human | 6809 | STX3 | syntaxin 3 | XM_005274195.4 | 100% | 100% | |
| 3 | human | 6809 | STX3 | syntaxin 3 | XM_017018188.1 | 97% | 96.5% | 1_1delAins22;5T>A;6_7insGCC |
| 4 | human | 6809 | STX3 | syntaxin 3 | XM_017018189.1 | 97% | 96.5% | 1_1delAins22;5T>A;6_7insGCC |
| 5 | human | 6809 | STX3 | syntaxin 3 | XM_017018190.1 | 97% | 96.5% | 1_1delAins22;5T>A;6_7insGCC |
| 6 | human | 6809 | STX3 | syntaxin 3 | XM_017018191.1 | 97% | 96.5% | 1_1delAins22;5T>A;6_7insGCC |
| 7 | human | 6809 | STX3 | syntaxin 3 | XM_005274198.3 | 95.2% | 93.7% | (many diffs) |
| 8 | human | 6809 | STX3 | syntaxin 3 | NM_001178040.2 | 93.4% | 92.3% | (many diffs) |
| 9 | human | 6809 | STX3 | syntaxin 3 | XM_017018192.1 | 92.2% | 90.3% | (many diffs) |
| 10 | human | 6809 | STX3 | syntaxin 3 | XM_017018193.1 | 92.2% | 90.3% | (many diffs) |
| 11 | human | 6809 | STX3 | syntaxin 3 | XM_017018194.1 | 90.4% | 88.9% | (many diffs) |
| 12 | human | 6809 | STX3 | syntaxin 3 | XM_005274200.4 | 87.1% | 87.1% | 673_674ins111 |
| 13 | human | 6809 | STX3 | syntaxin 3 | XM_017018195.1 | 84.1% | 83.7% | (many diffs) |
| 14 | human | 6809 | STX3 | syntaxin 3 | XM_011545221.2 | 66.4% | 66.4% | 0_1ins291 |
| 15 | human | 6809 | STX3 | syntaxin 3 | XM_017018196.1 | 53.6% | 53.6% | 0_1ins291;382_383ins111 |
| 16 | human | 6809 | STX3 | syntaxin 3 | XR_001747944.2 | 26.6% | 1_228del;1096_3251del | |
| 17 | mouse | 20908 | Stx3 | syntaxin 3 | NM_152220.2 | 91.6% | 97.9% | (many diffs) |
| 18 | mouse | 20908 | Stx3 | syntaxin 3 | NM_001025307.1 | 82.7% | 87.9% | (many diffs) |
| 19 | mouse | 20908 | Stx3 | syntaxin 3 | XM_006526844.3 | 78.9% | 81.8% | (many diffs) |
| 20 | mouse | 20908 | Stx3 | syntaxin 3 | XM_006526845.3 | 52.6% | 51.8% | (many diffs) |
| 21 | mouse | 20908 | Stx3 | syntaxin 3 | XM_017318108.1 | 52.6% | 51.8% | (many diffs) |
| 22 | mouse | 20908 | Stx3 | syntaxin 3 | XR_001782568.1 | 20.9% | (many diffs) | |
| 23 | mouse | 20908 | Stx3 | syntaxin 3 | XR_001782570.1 | 18.3% | (many diffs) | |
| 24 | mouse | 20908 | Stx3 | syntaxin 3 | XR_001782569.1 | 14.1% | (many diffs) | |
| 25 | mouse | 20908 | Stx3 | syntaxin 3 | XR_001782567.1 | 13.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 933
- ORF length:
- 867
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ggaccgtctg gagcagctga aggccaagca gctgacacag gatgatgata 121 ctgatgcggt tgagattgct atcgacaaca cggcttttat ggacgagttc ttttctgaga 181 ttgaggaaac tcggcttaac attgacaaga tctcagaaca tgtagaggag gctaagaaac 241 tctacagtat cattctctct gcaccgattc cagagccaaa aaccaaggat gacctagagc 301 agctcacgac tgagattaag aaaagggcca acaacgtccg gaacaaactg aagagcatgg 361 agaagcatat tgaagaagat gaggtcaggt catcggcaga ccttcggatt cggaaatccc 421 agcactctgt cctttctcgg aagtttgtgg aggtgatgac caaatacaat gaagctcaag 481 tggacttccg agaacgcagc aaagggcgaa tccagcggca gctcgaaatt actggcaaaa 541 agacaaccga tgaggagctg gaggagatgt tggagagtgg caacccggcc atcttcactt 601 ctgggatcat tgactcacag atttccaagc aagccctcag tgagattgag ggacgacaca 661 aggacattgt gaggctggag agcagcatca aggagcttca cgacatgttt atggacatcg 721 ccatgctggt ggagaatcag ggtgagatgt tagataacat agagttgaat gtcatgcaca 781 cagtggacca cgtggagaag gcacgagatg aaacgaaaaa agctgtgaaa taccagagtc 841 aGGCCCGGAA GAAATTGATA ATTATCATTG TGCTAGTAGT TGTGTTGCTG GGCATTTTAG 901 CATTGATTAT TGGACTTTCC GTTGGGCTGA ATTACCCAAC TTTCTTGTAC AAAGTGGTTG 961 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1021 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGGGAA AGGACGAAGG 1081 TACGACCTCG ACTATGCATT CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt 1141 tgtgaaagat t