Transcript: Human NM_152358.2

Homo sapiens IZUMO family member 2 (IZUMO2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
IZUMO2 (126123)
Length:
819
CDS:
88..753

Additional Resources:

NCBI RefSeq record:
NM_152358.2
NBCI Gene record:
IZUMO2 (126123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135404 GTACCAGATGGACAGCAAATA pLKO.1 612 CDS 100% 0.000 0.000 N IZUMO2 n/a
2 TRCN0000136824 CCAAACTTTGCCGCTTGCTAA pLKO.1 491 CDS 100% 4.950 3.960 N IZUMO2 n/a
3 TRCN0000137316 GAGGATCACTCCCAAGTGTAT pLKO.1 543 CDS 100% 4.950 3.465 N IZUMO2 n/a
4 TRCN0000135572 GACAAATCAACTGGACCTTGT pLKO.1 321 CDS 100% 4.050 2.835 N IZUMO2 n/a
5 TRCN0000135796 CATCCTCATTTCTGTGTCTCT pLKO.1 657 CDS 100% 2.640 1.848 N IZUMO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13114 pDONR223 100% 74.2% 74.2% None 1_171del n/a
2 ccsbBroad304_13114 pLX_304 0% 74.2% 74.2% V5 1_171del n/a
3 TRCN0000469782 CTCACGCGATGCTTAGCCGCCAGA pLX_317 69.9% 74.2% 74.2% V5 1_171del n/a
Download CSV