Transcript: Human NM_152394.5

Homo sapiens glutamate rich 6 (ERICH6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ERICH6 (131831)
Length:
2021
CDS:
23..2014

Additional Resources:

NCBI RefSeq record:
NM_152394.5
NBCI Gene record:
ERICH6 (131831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152394.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138163 CCGTTATATTGGAGTCCGCAT pLKO.1 1651 CDS 100% 2.160 3.024 N ERICH6 n/a
2 TRCN0000137182 GAGCCTTCTCTAAGAACGTTA pLKO.1 716 CDS 100% 4.950 3.960 N ERICH6 n/a
3 TRCN0000135815 CCAGAAGAGTCGAAACTAAAT pLKO.1 650 CDS 100% 13.200 9.240 N ERICH6 n/a
4 TRCN0000135083 CAATGGAAATGTCTGGGTATA pLKO.1 1507 CDS 100% 10.800 7.560 N ERICH6 n/a
5 TRCN0000136125 GCATCTTAGAACAAGACAAGA pLKO.1 1668 CDS 100% 4.950 3.465 N ERICH6 n/a
6 TRCN0000138162 CCTGCTATCATCCCAATGGAA pLKO.1 1494 CDS 100% 3.000 2.100 N ERICH6 n/a
7 TRCN0000136181 GCCAGTTTAATAAAGATCCGT pLKO.1 1814 CDS 100% 0.750 0.525 N ERICH6 n/a
8 TRCN0000137062 CCAATGGAAATGTCTGGGTAT pLKO.1 1506 CDS 100% 4.050 2.430 N ERICH6 n/a
9 TRCN0000136180 GAAGATGATTCAAAGCGCTTA pLKO.1 1127 CDS 100% 4.050 2.430 N ERICH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152394.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13164 pDONR223 100% 77.9% 77.9% None 1_438del n/a
2 ccsbBroad304_13164 pLX_304 0% 77.9% 77.9% V5 1_438del n/a
3 TRCN0000465704 AGTTGCTCGGTCCCTCTCATGAGT pLX_317 18.2% 77.9% 77.9% V5 1_438del n/a
Download CSV