Transcript: Human NM_152403.4

Homo sapiens EGF like, fibronectin type III and laminin G domains (EGFLAM), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
EGFLAM (133584)
Length:
4720
CDS:
197..3226

Additional Resources:

NCBI RefSeq record:
NM_152403.4
NBCI Gene record:
EGFLAM (133584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152403.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372061 CGACTTAGATTTGGATATTTC pLKO_005 994 CDS 100% 13.200 10.560 N EGFLAM n/a
2 TRCN0000053988 CGCATTGAACTGTACGGCTTT pLKO.1 328 CDS 100% 4.050 3.240 N EGFLAM n/a
3 TRCN0000053991 GCACACTAACAGGCAATATAT pLKO.1 3094 CDS 100% 15.000 10.500 N EGFLAM n/a
4 TRCN0000372116 ATGGAATTTGAGATCACATTT pLKO_005 2099 CDS 100% 13.200 9.240 N EGFLAM n/a
5 TRCN0000372060 CCATTGAGATCCCGCAGTTTA pLKO_005 2673 CDS 100% 13.200 9.240 N EGFLAM n/a
6 TRCN0000053989 GCTGCTCAGAAGATATTGTTA pLKO.1 1332 CDS 100% 5.625 3.938 N EGFLAM n/a
7 TRCN0000094130 CCAGATACCAACTACCAGTTT pLKO.1 818 CDS 100% 4.950 3.465 N Egflam n/a
8 TRCN0000053990 CGACAAGAAGTGGACCTCAAT pLKO.1 751 CDS 100% 4.950 3.465 N EGFLAM n/a
9 TRCN0000053992 GCTGTGAATGGGAGGAGAATT pLKO.1 1811 CDS 100% 0.000 0.000 N EGFLAM n/a
10 TRCN0000094131 CCTGACGTATGACAACCCAAA pLKO.1 2707 CDS 100% 4.050 2.835 N Egflam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152403.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09549 pDONR223 100% 99.9% 99.9% None 1418C>T;3000G>A n/a
2 ccsbBroad304_09549 pLX_304 0% 99.9% 99.9% V5 1418C>T;3000G>A n/a
3 TRCN0000467181 CGAGCTCGCTCGCCCCCGGCTCCG pLX_317 11.6% 99.9% 99.9% V5 1418C>T;3000G>A n/a
Download CSV