Transcript: Human NM_152407.4

Homo sapiens GrpE like 2, mitochondrial (GRPEL2), mRNA.

Source:
NCBI, updated 2019-08-16
Taxon:
Homo sapiens (human)
Gene:
GRPEL2 (134266)
Length:
4020
CDS:
42..719

Additional Resources:

NCBI RefSeq record:
NM_152407.4
NBCI Gene record:
GRPEL2 (134266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152407.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234886 ACACCCATTGGTGACAAATAT pLKO_005 540 CDS 100% 15.000 21.000 N GRPEL2 n/a
2 TRCN0000234888 ACTTCATGGCCGCACCATTAG pLKO_005 653 CDS 100% 10.800 15.120 N GRPEL2 n/a
3 TRCN0000337952 ACTTCATGGCCGCACCATTAG pLKO_005 653 CDS 100% 10.800 15.120 N Grpel2 n/a
4 TRCN0000234885 TGAACGAGCCTTAAGGGTAAA pLKO_005 215 CDS 100% 10.800 15.120 N GRPEL2 n/a
5 TRCN0000234887 TGGCACCGTGGCATTAGTAAG pLKO_005 617 CDS 100% 10.800 15.120 N GRPEL2 n/a
6 TRCN0000008585 GTGGCATTAGTAAGACAAGAT pLKO.1 624 CDS 100% 4.950 6.930 N GRPEL2 n/a
7 TRCN0000008584 GCGGTCTCTATAACAGGAATT pLKO.1 1040 3UTR 100% 0.000 0.000 N GRPEL2 n/a
8 TRCN0000234889 ATGGCTCTATTTGGGTAATTT pLKO_005 1500 3UTR 100% 15.000 12.000 N GRPEL2 n/a
9 TRCN0000008586 CTCTTGCTGAACGAGCCTTAA pLKO.1 208 CDS 100% 10.800 7.560 N GRPEL2 n/a
10 TRCN0000008587 GATATTTGGAATCCAGAGTTT pLKO.1 347 CDS 100% 4.950 3.465 N GRPEL2 n/a
11 TRCN0000008588 TCCAAGATTTAACAGTGAGAT pLKO.1 259 CDS 100% 4.950 3.465 N GRPEL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152407.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04890 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04890 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491526 GTTCTTTAGACCGAAATTCTCTTC pLX_317 43.5% 100% 100% V5 n/a
Download CSV