Transcript: Human NM_152417.3

Homo sapiens transmembrane protein 68 (TMEM68), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TMEM68 (137695)
Length:
2372
CDS:
225..998

Additional Resources:

NCBI RefSeq record:
NM_152417.3
NBCI Gene record:
TMEM68 (137695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370176 TTCCTGGATAATGCGTTAAAT pLKO_005 1305 3UTR 100% 15.000 21.000 N TMEM68 n/a
2 TRCN0000365123 CAGGATTCTGTGCCCTATATG pLKO_005 258 CDS 100% 13.200 18.480 N TMEM68 n/a
3 TRCN0000147520 GCCCTAATTAGTGATGAAACT pLKO.1 831 CDS 100% 4.950 6.930 N TMEM68 n/a
4 TRCN0000370175 GAGTAGTAGCTGATCACTTTG pLKO_005 682 CDS 100% 10.800 8.640 N TMEM68 n/a
5 TRCN0000147296 GAGTGCTTTGTTAGAACGTTT pLKO.1 971 CDS 100% 4.950 3.960 N TMEM68 n/a
6 TRCN0000128075 GAGTTCGAGAAGCCCTAATTA pLKO.1 820 CDS 100% 15.000 10.500 N TMEM68 n/a
7 TRCN0000377492 GAGCAGTTGGAGGACTATTTG pLKO_005 318 CDS 100% 13.200 9.240 N TMEM68 n/a
8 TRCN0000365124 GTAGGTCCTATAATTAGTATT pLKO_005 1077 3UTR 100% 13.200 9.240 N TMEM68 n/a
9 TRCN0000128172 CAGGAAACATTATGAGTGCTT pLKO.1 958 CDS 100% 2.640 1.848 N TMEM68 n/a
10 TRCN0000147088 CCAGCCTGAATGATGAATTTA pLKO.1 2130 3UTR 100% 15.000 9.000 N TMEM68 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13193 pDONR223 100% 50.3% 45.5% None (many diffs) n/a
2 ccsbBroad304_13193 pLX_304 0% 50.3% 45.5% V5 (many diffs) n/a
3 TRCN0000475274 AGTATTCTCGATTGGGTAATCACA pLX_317 74.1% 50.3% 45.5% V5 (many diffs) n/a
Download CSV