Transcript: Human NM_152474.5

Homo sapiens chromosome 19 open reading frame 18 (C19orf18), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
C19orf18 (147685)
Length:
915
CDS:
103..750

Additional Resources:

NCBI RefSeq record:
NM_152474.5
NBCI Gene record:
C19orf18 (147685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152474.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149894 GAACCTCAGGATACCGTTATT pLKO.1 522 CDS 100% 13.200 18.480 N C19orf18 n/a
2 TRCN0000147768 GATGGCAATCTCCTATATGAT pLKO.1 450 CDS 100% 5.625 4.500 N C19orf18 n/a
3 TRCN0000147297 GAATGCGTCACATAATGGAAA pLKO.1 714 CDS 100% 4.950 3.960 N C19orf18 n/a
4 TRCN0000435468 ATGGAATGCCAACTTCATTTA pLKO_005 148 CDS 100% 13.200 9.240 N C19orf18 n/a
5 TRCN0000149459 GCATAGACCTGCTCTTGTTAA pLKO.1 381 CDS 100% 13.200 9.240 N C19orf18 n/a
6 TRCN0000430079 TGAAATTCCTGAGGAATAAAG pLKO_005 350 CDS 100% 13.200 9.240 N C19orf18 n/a
7 TRCN0000149307 GAGCCCAAAGTGTTCTTTCAT pLKO.1 262 CDS 100% 5.625 3.938 N C19orf18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152474.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04997 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04997 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476607 TACCGGTAGGTTAGGTGCCACGCT pLX_317 47.7% 100% 100% V5 n/a
Download CSV