Transcript: Human NM_152516.3

Homo sapiens copper metabolism domain containing 1 (COMMD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
COMMD1 (150684)
Length:
751
CDS:
38..610

Additional Resources:

NCBI RefSeq record:
NM_152516.3
NBCI Gene record:
COMMD1 (150684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152516.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436958 TGCTACGGAGCCAGCTATATC pLKO_005 138 CDS 100% 13.200 18.480 N COMMD1 n/a
2 TRCN0000439509 GATGGCAAGTCTCAGTCAAGG pLKO_005 416 CDS 100% 4.050 5.670 N COMMD1 n/a
3 TRCN0000438485 ACTGATCAGCCAGCCTAACTG pLKO_005 589 CDS 100% 4.950 3.465 N COMMD1 n/a
4 TRCN0000444197 ATGAACCAGAGCCGCTGGAAT pLKO_005 365 CDS 100% 4.950 3.465 N COMMD1 n/a
5 TRCN0000167145 CAAAGTCAACCAAATTCTGAA pLKO.1 535 CDS 100% 4.950 3.465 N COMMD1 n/a
6 TRCN0000439491 AGCAAGGTGGGATCACATCTG pLKO_005 282 CDS 100% 4.050 2.835 N COMMD1 n/a
7 TRCN0000168455 GCTCAAATACACACACCTGTT pLKO.1 443 CDS 100% 4.050 2.835 N COMMD1 n/a
8 TRCN0000414047 GGCATTCTTGACTGCTCAAAC pLKO_005 256 CDS 100% 10.800 6.480 N COMMD1 n/a
9 TRCN0000167998 CAAGCTGCTGTCATTTCCAAA pLKO.1 305 CDS 100% 4.950 2.970 N COMMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152516.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09673 pDONR223 100% 99.8% 100% None 492T>C n/a
2 ccsbBroad304_09673 pLX_304 0% 99.8% 100% V5 492T>C n/a
3 TRCN0000474347 GGGACAAACCCGGACCGAGTTCTA pLX_317 62% 99.6% 43.2% V5 (not translated due to prior stop codon) 240_241insA;492T>C n/a
Download CSV