Transcript: Human NM_152595.5

Homo sapiens piggyBac transposable element derived 4 (PGBD4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PGBD4 (161779)
Length:
6604
CDS:
450..2207

Additional Resources:

NCBI RefSeq record:
NM_152595.5
NBCI Gene record:
PGBD4 (161779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152595.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413520 AGTGGACTCGGCTGATCAAAT pLKO_005 1739 CDS 100% 13.200 18.480 N PGBD4 n/a
2 TRCN0000136825 CGTGCTATGATTCCACGTCAA pLKO.1 681 CDS 100% 4.050 5.670 N PGBD4 n/a
3 TRCN0000136163 GATAGTGCTTTAGAAGCCGAT pLKO.1 576 CDS 100% 2.160 3.024 N PGBD4 n/a
4 TRCN0000427457 ACGTGTCATTGTGGATTATAA pLKO_005 1703 CDS 100% 15.000 10.500 N PGBD4 n/a
5 TRCN0000134002 CCTGGCATGAATTTGAAAGAT pLKO.1 1338 CDS 100% 5.625 3.938 N PGBD4 n/a
6 TRCN0000134298 GACTGGCATTGATTGAAAGAA pLKO.1 1906 CDS 100% 5.625 3.938 N PGBD4 n/a
7 TRCN0000133883 CCAGATTTCATTGCAGAAGAT pLKO.1 1106 CDS 100% 4.950 3.465 N PGBD4 n/a
8 TRCN0000135367 GCCATTAGCTATGAAGCAGTA pLKO.1 1223 CDS 100% 4.050 2.835 N PGBD4 n/a
9 TRCN0000135497 GAACAGTTGTTGGCTGAAGAT pLKO.1 504 CDS 100% 4.950 2.970 N PGBD4 n/a
10 TRCN0000416705 GCACACGATGAGCCATATAAA pLKO_005 1880 CDS 100% 15.000 7.500 Y PGBD4 n/a
11 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 5834 3UTR 100% 13.200 6.600 Y LRRC74B n/a
12 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2336 3UTR 100% 4.950 2.475 Y ORAI2 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4088 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5764 3UTR 100% 4.950 2.475 Y n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4089 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2424 3UTR 100% 10.800 5.400 Y SMIM11A n/a
17 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2333 3UTR 100% 4.950 2.475 Y LOC339059 n/a
18 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3585 3UTR 100% 4.950 2.475 Y KAAG1 n/a
19 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 5899 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152595.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05113 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05113 pLX_304 0% 100% 100% V5 n/a
Download CSV