Transcript: Human NM_152653.4

Homo sapiens ubiquitin conjugating enzyme E2 E2 (UBE2E2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
UBE2E2 (7325)
Length:
2715
CDS:
147..752

Additional Resources:

NCBI RefSeq record:
NM_152653.4
NBCI Gene record:
UBE2E2 (7325)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152653.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011179 CCGCTGCTAAATTGTCAACTA pLKO.1 292 CDS 100% 4.950 3.960 N UBE2E2 n/a
2 TRCN0000040960 GACCCAAAGGAGACAACATTT pLKO.1 379 CDS 100% 13.200 9.240 N Ube2e2 n/a
3 TRCN0000011178 CCGATGGAGATCAACGTGAAA pLKO.1 202 CDS 100% 4.950 3.465 N UBE2E2 n/a
4 TRCN0000011180 CGTGAAAGTGTTCAGCAAGAA pLKO.1 216 CDS 100% 4.950 3.465 N UBE2E2 n/a
5 TRCN0000011181 CGCCACACAGTACATGACCAA pLKO.1 677 CDS 100% 2.640 1.848 N UBE2E2 n/a
6 TRCN0000011177 GCTTTCTTACAAAGCTTTGTA pLKO.1 1072 3UTR 100% 0.563 0.394 N UBE2E2 n/a
7 TRCN0000040961 CAAGCACTAGTGGAGGAAGTT pLKO.1 181 CDS 100% 0.000 0.000 N Ube2e2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152653.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01737 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01737 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491351 TATATGCCAGTGTTGGAGCAGTAC pLX_317 41.4% 100% 100% V5 n/a
4 ccsbBroadEn_02448 pDONR223 100% 76.8% 85.9% None (many diffs) n/a
5 ccsbBroad304_02448 pLX_304 0% 76.8% 85.9% V5 (many diffs) n/a
Download CSV